Htin Lin Aung

A1Ao-ATP Synthase of Methanobrevibacter ruminantium Couples Sodium Ions for ATP Synthesis under Physiological Conditions

Background: An enigma in the bioenergetics of methanogens is how the generation of proton and sodium gradients are used to synthesize ATP. Results: Purified methanogen ATP synthase was stimulated by sodium ions that also provided pH-dependent protection against DCCD. Conclusion: Methanobrevibacter ruminantium harbors an A-type enzyme with the ability to switch between sodium ions and protons. Significance: ATP synthesis by methanogens depends on the environmental conditions that prevail. An unresolved question in the bioenergetics of methanogenic archaea is how the generation of proton-motive and sodium-motive forces during methane production is used to synthesize ATP by the membrane-bound A1Ao-ATP synthase, with both proton- and sodium-coupled enzymes being reported in methanogens. To address this question, we investigated the biochemical characteristics of the A1Ao-ATP synthase (MbbrA1Ao) of Methanobrevibacter ruminantium M1, a predominant methanogen in the rumen. Growth of M. ruminantium M1 was inhibited by protonophores and sodium ionophores, demonstrating that both ion gradients were essential for growth. To study the role of these ions in ATP synthesis, the ahaHIKECFABD operon encoding the MbbrA1Ao was expressed in Escherichia coli strain DK8 (Δatp) and purified yielding a 9-subunit protein with an SDS-stable c oligomer. Analysis of the c subunit amino acid sequence revealed that it consisted of four transmembrane helices, and each hairpin displayed a complete Na+-binding signature made up of identical amino acid residues. The purified MbbrA1Ao was stimulated by sodium ions, and Na+ provided pH-dependent protection against inhibition by dicyclohexylcarbodiimide but not tributyltin chloride. ATP synthesis in inverted membrane vesicles lacking sodium ions was driven by a membrane potential that was sensitive to cyanide m-chlorophenylhydrazone but not to monensin. ATP synthesis could not be driven by a chemical gradient of sodium ions unless a membrane potential was imposed. ATP synthesis under these conditions was sensitive to monensin but not cyanide m-chlorophenylhydrazone. These data suggest that the M. ruminantium M1 A1Ao-ATP synthase exhibits all the properties of a sodium-coupled enzyme, but it is also able to use protons to drive ATP synthesis under conditions that favor proton coupling, such as low pH and low levels of sodium ions.

Hypoxia-Activated Cytochrome bd Expression in Mycobacterium smegmatis Is Cyclic AMP Receptor Protein Dependent

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

Whole-genome sequencing of multidrug-resistant Mycobacterium tuberculosis isolates from Myanmar

Highlights • Drug-resistant tuberculosis (TB) is a major health threat in Myanmar.• The first whole-genome sequencing study of drug-resistant TB from Myanmar.• Introduction of second-line drug susceptibility testing as part of routine diagnosis in Myanmar is needed.

Overexpression of a newly identified d-amino acid transaminase in Mycobacterium smegmatis complements glutamate racemase deletion

Glutamate racemase (MurI) has been proposed as a target for anti‐tuberculosis drug development based on the inability of ΔmurI mutants of Mycobacterium smegmatis to grow in the absence of d‐glutamate. In this communication, we identify ΔmurI suppressor mutants that are detected during prolonged incubation. Whole genome sequencing of these ΔmurI suppressor mutants identified the presence of a SNP, located in the promoter region of MSMEG_5795. RT‐qPCR and transcriptional fusion analyses revealed that the ΔmurI suppressor mutant overexpressed MSMEG_5795 14‐fold compared to the isogenic wild‐type. MSMEG_5795, which is annotated as 4‐amino‐4‐deoxychorismate lyase (ADCL) but which also has homology to d‐amino acid transaminase (d‐AAT), was expressed, purified and found to have d‐AAT activity and to be capable of producing d‐glutamate from d‐alanine. Consistent with its d‐amino acid transaminase function, overexpressed MSMEG_5795 is able to complement both ΔmurI deletion mutants and alanine racemase (Δalr) deletion mutants, thus confirming a multifunctional role for this enzyme in M. smegmatis.

Role of alanine racemase mutations in Mycobacterium tuberculosis D-cycloserine resistance.

ABSTRACT A screening of more than 1,500 drug-resistant strains of Mycobacterium tuberculosis revealed evolutionary patterns characteristic of positive selection for three alanine racemase (Alr) mutations. We investigated these mutations using molecular modeling, in vitro MIC testing, as well as direct measurements of enzymatic activity, which demonstrated that these mutations likely confer resistance to d-cycloserine.

Structure and Function of AmtR in Mycobacterium smegmatis: Implications for Post-Transcriptional Regulation of Urea Metabolism through a Small Antisense RNA.

Soil-dwelling bacteria of the phylum actinomycetes generally harbor either GlnR or AmtR as a global regulator of nitrogen metabolism. Mycobacterium smegmatis harbors both of these canonical regulators; GlnR regulates the expression of key genes involved in nitrogen metabolism, while the function and signal transduction pathway of AmtR in M. smegmatis remains largely unknown. Here, we report the structure and function of the M. smegmatis AmtR and describe the role of AmtR in the regulation of nitrogen metabolism in response to nitrogen availability. To determine the function of AmtR in M. smegmatis, we performed genome-wide expression profiling comparing the wild-type versus an ∆amtR mutant and identified significant changes in the expression of 11 genes, including an operon involved in urea degradation. An AmtR consensus-binding motif (CTGTC-N4-GACAG) was identified in the promoter region of this operon, and ligand-independent, high-affinity AmtR binding was validated by both electrophoretic mobility shift assays and surface plasmon resonance measurements. We confirmed the transcription of a cis-encoded small RNA complementary to the gene encoding AmtR under nitrogen excess, and we propose a post-transcriptional regulatory mechanism for AmtR. The three-dimensional X-ray structure of AmtR at 2.0Å revealed an overall TetR-like dimeric structure, and the alignment of the M. smegmatis AmtR and Corynebacterium glutamicum AmtR regulatory domains showed poor structural conservation, providing a potential explanation for the lack of M. smegmatis AmtR interaction with the adenylylated PII protein. Taken together, our data suggest an AmtR (repressor)/GlnR (activator) competitive binding mechanism for transcriptional regulation of urea metabolism that is controlled by a cis-encoded small antisense RNA.

A high-throughput screening assay for identification of inhibitors of the A1AO-ATP synthase of the rumen methanogen Methanobrevibacter ruminantium M1

We report the development of a high-throughput screening platform to identify inhibitors of the membrane-bound A1Ao-ATP synthase from the rumen methanogen Methanobrevibacter ruminantium M1. Inhibitors identified in the screen were tested against growing cultures of M. ruminantium, validating the approach to identify new inhibitors of methanogens.

Characterisation of the DNA gyrase from the thermophilic eubacterium Thermus thermophilus.

DNA gyrase is a type IIA topoisomerase found in bacteria but not in humans. The enzyme is required for bacterial DNA replication and transcription, and is an important antibacterial target that is sensitive to the widely-used fluoroquinolone drugs. Due to the emergence of fluoroquinolone resistance, the discovery of new classes of drugs that target DNA gyrase is urgent. The DNA gyrase holoenzyme is a heterodimer of subunit pairs (A2B2). The 90 kDa A subunits bind, cleave, and rejoin double stranded DNA. The enzyme introduces negative supercoils into closed circular bacterial DNA using ATP hydrolysis catalysed by the 70 kDa B subunits. Subdomains of DNA gyrase subunits have been crystallised for structural analysis and the resulting models used to improve drugs that target the DNA binding region and active site. While crystal structures are available for topoisomerase IV complexes with cleaved DNA, there is none for the complete DNA gyrase complex with substrate DNA bound. Thermophiles offer significant advantages in obtaining stable enzymes for structural and functional studies. In order to develop a capability for drug screening and structure-directed drug discovery we have reconstituted a functional and drug-sensitive DNA gyrase complex using heterologously expressed subunits from the thermophile Thermus thermophilus.

Draft Genome Sequences of Two Drug-Resistant Mycobacterium tuberculosis Isolates from Myanmar

ABSTRACT Multidrug-resistant tuberculosis (MDR-TB) and lately, extensively drug-resistant TB (XDR-TB) are increasing global health concerns. Here, we present the genome sequences of two MDR-TB isolates from Myanmar, one of 27 countries with a high MDR-TB burden, and describe a number of mutations consistent with these being XDR-TB isolates.

Novel regulatory roles of cAMP receptor proteins in fast-growing environmental mycobacteria.

Mycobacterium smegmatis is a fast-growing, saprophytic, mycobacterial species that contains two cAMP-receptor protein (CRP) homologues designated herein as Crp1 and Crp2. Phylogenetic analysis suggests that Crp1 (Msmeg_0539) is uniquely present in fast-growing environmental mycobacteria, whereas Crp2 (Msmeg_6189) occurs in both fast- and slow-growing species. A crp1 mutant of M. smegmatis was readily obtained, but crp2 could not be deleted, suggesting it was essential for growth. A total of 239 genes were differentially regulated in response to crp1 deletion (loss of function), including genes coding for mycobacterial energy generation, solute transport and catabolism of carbon sources. To assess the role of Crp2 in M. smegmatis, the crp2 gene was overexpressed (gain of function) and transcriptional profiling studies revealed that 58 genes were differentially regulated. Identification of the CRP promoter consensus in M. smegmatis showed that both Crp1 and Crp2 recognized the same consensus sequence (TGTGN8CACA). Comparison of the Crp1- and Crp2-regulated genes revealed distinct but overlapping regulons with 11 genes in common, including those of the succinate dehydrogenase operon (MSMEG_0417-0420, sdh1). Expression of the sdh1 operon was negatively regulated by Crp1 and positively regulated by Crp2. Electrophoretic mobility shift assays with purified Crp1 and Crp2 demonstrated that Crp1 binding to the sdh1 promoter was cAMP-independent whereas Crp2 binding was cAMP-dependent. These data suggest that Crp1 and Crp2 respond to distinct signalling pathways in M. smegmatis to coordinate gene expression in response to carbon and energy supply.