Hyemin Lim

Role of the plastidic glucose translocator in the export of starch degradation products from the chloroplasts in Arabidopsis thaliana

In higher plants, the plastidic glucose translocator (pGlcT) is assumed to play a role in the export of starch degradation products, but this has not yet been studied in detail. To elucidate the role of pGlcT in the leaves of Arabidopsis thaliana, we generated single and double mutants lacking three plastidic sugar transporters, pGlcT, the triose-phosphate/phosphate translocator (TPT), and the maltose transporter (MEX1), and analyzed their growth phenotypes, photosynthetic properties and metabolite contents. In contrast to the pglct-1 and pglct-2 single mutants lacking a visible growth phenotype, the double mutants pglct-1/mex1 and tpt-2/mex1 displayed markedly inhibited plant growth. Notably, pglct-1/mex1 exhibited more severe growth retardation than that seen for the other mutants. In parallel, the most severe reductions in sucrose content and starch turnover were observed in the pglct-1/mex1 mutant. The concurrent loss of pGlcT and MEX1 also resulted in severely reduced photosynthetic activities and extreme chloroplast abnormalities. These findings suggest that pGlcT, together with MEX1, contributes significantly to the export of starch degradation products from chloroplasts in A. thaliana leaves, and that this starch-mediated pathway for photoassimilate export via pGlcT and MEX1 is essential for the growth and development of A. thaliana.

Map-based Cloning and Characterization of the BPH18 Gene from Wild Rice Conferring Resistance to Brown Planthopper (BPH) Insect Pest

Brown planthopper (BPH) is a phloem sap-sucking insect pest of rice which causes severe yield loss. We cloned the BPH18 gene from the BPH-resistant introgression line derived from the wild rice species Oryza australiensis. Map-based cloning and complementation test revealed that the BPH18 encodes CC-NBS-NBS-LRR protein. BPH18 has two NBS domains, unlike the typical NBS-LRR proteins. The BPH18 promoter::GUS transgenic plants exhibited strong GUS expression in the vascular bundles of the leaf sheath, especially in phloem cells where the BPH attacks. The BPH18 proteins were widely localized to the endo-membranes in a cell, including the endoplasmic reticulum, Golgi apparatus, trans-Golgi network, and prevacuolar compartments, suggesting that BPH18 may recognize the BPH invasion at endo-membranes in phloem cells. Whole genome sequencing of the near-isogenic lines (NILs), NIL-BPH18 and NIL-BPH26, revealed that BPH18 located at the same locus of BPH26. However, these two genes have remarkable sequence differences and the independent NILs showed differential BPH resistance with different expression patterns of plant defense-related genes, indicating that BPH18 and BPH26 are functionally different alleles. These findings would facilitate elucidation of the molecular mechanism of BPH resistance and the identified novel alleles to fast track breeding BPH resistant rice cultivars.

Proteomic identification of rhythmic proteins in rice seedlings

Many aspects of plant metabolism that are involved in plant growth and development are influenced by light-regulated diurnal rhythms as well as endogenous clock-regulated circadian rhythms. To identify the rhythmic proteins in rice, periodically grown (12h light/12h dark cycle) seedlings were harvested for three days at six-hour intervals. Continuous dark-adapted plants were also harvested for two days. Among approximately 3000 reproducible protein spots on each gel, proteomic analysis ascertained 354 spots (~12%) as light-regulated rhythmic proteins, in which 53 spots showed prolonged rhythm under continuous dark conditions. Of these 354 ascertained rhythmic protein spots, 74 diurnal spots and 10 prolonged rhythmic spots under continuous dark were identified by MALDI-TOF MS analysis. The rhythmic proteins were functionally classified into photosynthesis, central metabolism, protein synthesis, nitrogen metabolism, stress resistance, signal transduction and unknown. Comparative analysis of our proteomic data with the public microarray database (the Plant DIURNAL Project) and RT-PCR analysis of rhythmic proteins showed differences in rhythmic expression phases between mRNA and protein, suggesting that the clock-regulated proteins in rice are modulated by not only transcriptional but also post-transcriptional, translational, and/or post-translational processes.

Altered expression of pyrophosphate: Fructose-6-phosphate 1-phosphotransferase affects the growth of transgenic Arabidopsis plants

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of fructose-6-phosphate and fructose-1,6-bisphosphate, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP sub-unit genes. The overexpressing lines displayed increased PFP activity and slightly faster growth relative to wild type plants, although their photosynthetic activities and the levels of metabolites appeared not to have significantly changed. In contrast, the RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO2 assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPβ affects the expression of several genes involved in diverse physiological processes. Our current data thus suggest that PFP is important in carbohydrate metabolism and other cellular processes.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase is involved in the tolerance of Arabidopsis seedlings to salt and osmotic stresses

In plants, pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) is a regulatory enzyme that participates in glycolysis and gluconeogenesis. Arabidopsis contains two PFPα subunit genes (PFPα1 and PFPα2) and two PFPβ subunit genes (PFPβ1 and PFPβ2). The single-knockout mutants of the PFP subunit genes were isolated, and double and quadruple pfp mutants were generated by crossing the single mutants. To elucidate the role of PFP in stress tolerance, the responses of the double and quadruple pfp knockout mutants to stress conditions, including osmotic and salt stresses, were examined. The seedling growth of the pfpα1/α2 and pfpβ1/β2 double mutants and the pfpα1/α2/β1/β2 quadruple mutant was severely retarded under salt and osmotic stress conditions compared with that of the wild type. The expression of PFP subunit genes increased in response to salt and osmotic stresses. In contrast, the vegetative growth of the wild type and pfp mutants after the seedling stage was similarly affected by salt and osmotic stresses. These findings suggest that PFP plays a role in the adaptation of Arabidopsis seedlings to salt and osmotic stresses.

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2 gene that is essential for expression

Arabidopsis harbors two α and two β genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPα genes were analyzed using transgenic plants containing a promoter::ß-glucuronidase (GUS) fusion construct. Whereas the AtPFPα1 promoter was found to be ubiquitously active in all tissues, the AtPFPα2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPα2 promoter identified a key regulatory element from nucleotides −194 to −175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 and which is essential for AtPFPα2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a −46 CaMV35S minimal promoter, we also demonstrate that PFPα2 is sufficient for normal AtPFPα2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPα2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Whole-Genome Resequencing and Transcriptomic Analysis to Identify Genes Involved in Leaf-Color Diversity in Ornamental Rice Plants

Rice field art is a large-scale art form in which people design rice fields using various kinds of ornamental rice plants with different leaf colors. Leaf color-related genes play an important role in the study of chlorophyll biosynthesis, chloroplast structure and function, and anthocyanin biosynthesis. Despite the role of different metabolites in the traditional relationship between leaf and color, comprehensive color-specific metabolite studies of ornamental rice have been limited. We performed whole-genome resequencing and transcriptomic analysis of regulatory patterns and genetic diversity among different rice cultivars to discover new genetic mechanisms that promote enhanced levels of various leaf colors. We resequenced the genomes of 10 rice leaf-color accessions to an average of 40× reads depth and >95% coverage and performed 30 RNA-seq experiments using the 10 rice accessions sampled at three developmental stages. The sequencing results yielded a total of 1,814 × 106 reads and identified an average of 713,114 SNPs per rice accession. Based on our analysis of the DNA variation and gene expression, we selected 47 candidate genes. We used an integrated analysis of the whole-genome resequencing data and the RNA-seq data to divide the candidate genes into two groups: genes related to macronutrient (i.e., magnesium and sulfur) transport and genes related to flavonoid pathways, including anthocyanidin biosynthesis. We verified the candidate genes with quantitative real-time PCR using transgenic T-DNA insertion mutants. Our study demonstrates the potential of integrated screening methods combined with genetic-variation and transcriptomic data to isolate genes involved in complex biosynthetic networks and pathways.

Functional conservation of MtFPA, a nucleus-localized RNA-recognition motif-binding protein that regulates flowering time in Medicago truncatula

The FLOWERING TIME CONTROL PROTEIN FPA (FPA) gene encodes an RNA recognition motif (RRM) domain protein and plays an important role in flowering time control. Flowering responds to environmental conditions and developmental regulation through a network of signaling pathways. However, a little is known about the functions of autonomous pathway genes in Medicago truncatula. Here, we characterized the M. truncatula FPA (MtFPA) gene expression profiling through quantitative RT-PCR analysis, cellular localization, and functional analyses in transgenic plants. We cloned the FPA gene of M. truncatula based on its sequence similarity with Arabidopsis thaliana FPA. The quantitative RT-PCR analysis of MtFPA expression patterns showed that the MtFPA transcripts accumulated ubiquitously in the roots, leaves, stems, flowers, and pods of M. truncatula. The confocal image analysis of the fusion protein MtFPA:GFP revealed that MtFPA was localized in the nucleus. To examine the function of MtFPA, the 35S::MtFPA transgenic plants were generated in the Arabidopsis late-flowering mutant background, fpa-2. The overexpression of MtFPA accelerated flowering under long day conditions compared to the non-transgenic plants. In MtFPA transgenic lines, the expression of AtFLC was down-regulated, whereas that of the floral integrators, AtFT and AtSOC1, was up-regulated as compared to the control plants. These results suggest that MtFPA is a functional orthologue of Arabidopsis and plays an important role in the regulation of flowering time in legumes, especially in M. truncatula.

Overexpression of BrTSR53 gene improves tolerance of rice plant to salt stress.

Plant is frequently exposed to various abiotic stress. Salt stress is particularly an important abiotic stress that seriously affects plant growth and development. BrTSR53 gene, a putative stress-related gene isolated from Brassica rapa, was used to generate overexpression transgenic rice. The over-expression of BrTSR53 in BrTSR53-OX transgenic rice was confirmed by quantitative RT-PCR and western blot analysis. To elucidate the role of BrTSR53 in stress tolerance, responses of BrTSR53-OX transgenic rice plants to salt stress conditions were examined. BrTSR53-OX #12, #28, and #32 lines were treated with salt stress on MS medium containing 100 mM or 200 mM of NaCl for 5 and 14 days. Morphological analysis revealed differences between the three transgenic BrTSR53-OX rice and the wild-type rice. The germination rates of the three transgenic BrTSR53-OX lines of rice were significantly higher than that of the wild type rice, indicating that they were more tolerant to 200 mM NaCl than the wild type rice. In addition, the three transgenic BrTSR53-OX rice lines had significantly longer length of root and shoot compared to the wild type rice. These results suggest that the BrTSR53 gene played an important role in the tolerance of rice to salt stress. Therefore, it might be a potential target for the purpose of improving salt tolerance of rice and other crops.