I. G. Meschersky

Behavioral Responses of Dwarf Hamsters (Phodopus Roborovskii and Phodopus Sungorus) to Same-Sex and Opposite-Sex Odors in Different Seasons

Adult male Phodopus roborovskii and Phodopus sungorus were maintained outdoors throughout the year. Investigation of odors of urine, feces, and mid-ventral gland secretion of both sexes was examined. It was found that the males of the two species showed different reactions to the same stimuli. Also, the responses to the same stimuli differed according to season in both species. It was shown that urine is the main odor stimulus in sex recognition; the males of both species spent more time (p<0.05) sniffing opposite-sex odor in all seasons. P. sungorus males sniffed own-sex odor of mid-ventral gland secretion longer (p<0.05) in all seasons. P roborovskii males showed a preference (p<0.05) for own-sex mid-ventral gland odor only in summer (during the peak of breeding); males of this species did not prefer male or female feces odor in any season. In summer P. sungorus sniffed the feces of females longer (p<0.05) than that of males. Thus, feces odor may be an additional source for sex recognition in P. sungorus.

Genetic structure of urban population of the common hamster (Cricetus cricetus)

Over the past half-century, the common hamster (Cricetus cricetus), along with range-wide decline of natural populations, has actively populated the cities. The study of the genetic structure of urban populations of common hamster may shed light on features of the habitation of this species in urban landscapes. This article is focused on the genetic structure of common hamster populations in Simferopol (Crimea), one of the largest known urban populations of this species. On the basis of the analysis of nucleotide sequences of the cytochrome b gene and mtDNA control region, and the allelic composition of ten microsatellite loci of nDNA, we revealed that, despite the fact that some individuals can move throughout the city at considerable distances, the entire population of the city is represented by separate demes confined to different areas. These demes are characterized by a high degree of the genetic isolation and reduced genetic diversity compared to that found for the city as a whole.

Phylogeography of the European rock rose Helianthemum nummularium s.l. (Cistaceae): western richness and eastern poverty

Helianthemum nummularium s.l. is a young, morphologically diverse species distributed from western Europe to the Caucasus and the Southern Urals in the east. We analysed the rps16-trnK plastid intergenic spacer sequences from 85 localities covering most of the range of H. nummularium. Thirteen haplotypes were very unevenly distributed throughout the range of the species, and exhibited a strong phylogeographic signal. The results confirm range expansions of H. nummularium from Mediterranean refugia northwards, but also show the major role of eastern European (the Caucasus and the Southern Urals) refugia in rapid postglacial colonization of east, north and central Europe. The plastid haplotypes form distinct clades, one representing an eastern European lineage with few haplotypes and the other representing a western European lineage with many haplotypes. Parallel to this split in haplotype diversity is the pronounced differentiation in morphological variation displayed by the taxa found in west and east Europe. We discuss the role of topography in generating differences in morphological and genetic diversity between these two groups. We also discuss the taxonomical status of Helianthemum arcticum, which is regarded as an endangered local endemic of the Kola Peninsula. Helianthemum arcticum appears to represent an outlying peripheral population of H. nummularium preserved since the last postglacial major range expansion of this species, and bears the same plastid haplotype as the bulk of east and north European populations.

The Mountain Weasel Mustela kathiah (Carnivora: Mustelidae): Molecular and Karyological Data

The karyotype of Mustela kathiah was first described. Its structure is most similar to the karyotype of M. altaica, differing in the morphological peculiarities of five pairs of large chromosomes. A comparative analysis of mitochondrial genes in the species Mustela allowed us to clarify understanding of the place of M. kathiah in the system of the genus. The earlier hypothesized proximity of the species to a group of small weasels (altaica, nivalis) or to a group of South Asian species (strigidorsa, nudipes) was not confirmed. A high level of differences between M. kathiah of Vietnam and specimens from southern China in nucleotide sequences of the cytochrome b (7.7%) and ND2 (6–6.2%) genes was found. It is supposed that difference in the two gene sequences found in geographically distanced populations of M. kathiah may be adaptive.

Geographical Variation of the Marbled Polecat Vormela peregusna (Carnivora: Mustelidae): Molecular Genetic Study

(Guldens-taedt, 1770) remains the least studied member of thefamily Mustelidae. Our previous molecular geneticanalysis [1] provided more specific information on phy-logenetic relationships of the genus; however, theintraspecific structure of the marbled polecat is stillunknown, although the species area is rather extendedand covers the entire steppe, desert, and semidesertzones of Eurasia. Sequencing the mitochondrial DNAof marbled polecats from southern Russia, Transcauca-sia, Turkmenistan, and Uzbekistan showed a highdegree of the species genetic homogeneity in a largepart of the area, and no distinctions were found betweenanimals from the above regions, though some of thesepopulations are now assumed to be valid subspecies.Among numerous marbled polecat forms that weredescribed at different times, the following ones are nowvalid: V. p. peregusna, V. p. syriaca, V. p. pallidior,V. p. euxina, V. p. koshevnikovi, and V. p. negans [2].The taxonomy of marbled polecats from some regions(Kyzyl Kum, Transcaucasia, Tadjikistan, etc.) remainsunknown.The following samples were the objects of ourstudy. Southern Russia: VP1_KLM ([1]: VP1),Kalmykia, 2002; VP2_RST ([1]: VP2), Rostov oblast,1999. Transcaucasia: VP5-2_ARM, Armenia, nearLake Sevan, 2005 (muscles preserved in alcohol); VP5-3_AZR, Azerbaijan, Lachin outskirts, the ZabukhRiver, 1999 (a dry skin). Turkmenistan: VP4-4_TRK(the collection of the Zoological Institute (ZIN) of theRussian Academy of Sciences: C.51339), VP4-5_TRK(ZIN: C.51340), and VP4-7_TRK (ZIN: C.51403); allthe three samples were from southeastern Kara Kum,1964; VP4-6_TRK (ZIN: C.40194), Kushka outskirts,1956; VP4-8_TRK (ZIN: C.48161), Mary outskirts,1960; The material from ZIN consisted of ZIN collec-tion fingers on dry skins. Uzbekistan (Kysyl Kum):VP3-2_UZB ([1]: VP3), 1991, VP3-7_UZB, 1993,both samples were from Bukhara oblast, 25 km south-east of Bukhara, dry skins.For all 11 samples, the left domain sequences of themtDNA control region were determined (253–256 bp,256 positions); for samples VP5-3_AZR, VP4-6_TRK,and VP3-2_UZB, the complete sequences of the cyto-chrome b gene (1140 bp) were determined; for the sam-ples VP1_KLM, VP2_RST, VP5-2_ARM, VP4-4_TRK, and VP4-7_TRK, the complete sequences ofboth cytochrome b gene and the mtDNA control region(1085–1108 bp, 1109 positions) were determined.DNA was extracted as described previously [1]. Forthe cytochrome b gene amplification, internal primersCVS-r2 (cgggtttaatatggggtggt) and CVS-f2 (atattccca-gaaacatgaaacatc) were designed as pairs to the previ-ously used CVS-f1 and CVS-r1 primers [1]. For ampli-fication of the control region, we developed pairs ofprimers DVS-f1 (cctccctaagactcaaggaagaa)–DVS-r2(tgtcctgtgaccattgactga) and DVS-f2 (aatcagcccatgatca-caca )– DVS - r 1 ( ggctaggaccaaacctttatg ). The PCR pro-file was were the following: I, 94 ° C for 3 min; II, 94 ° Cfor 45 s, 54 ° C for 1.5 min, and 70 ° C for 2 min(30 cycles); III, 70 ° C for 3 min. For some samples withunstable DNA, primer DVS-r3 (ttatgtgtgatcatgggctga)or DVS-r4 (ccagatgccaggtatagtttca) was used togetherwith the DVS-f1 primer to amplificate the left domainof the control region. All primers were constructedusing the Primer3 software [3].Both both strands of each mtDNA region were rec-ognized for each region of every sample (an ABIPRISM 310 analyzer; BigDye Terminator v.3.1reagents as described in [1]). The sequences werematched using the BioEdit v.7.0.1 software [4]. Thecontrol region borders were determined by alignment

Phylogeographic structure of the Common hamster (Cricetus cricetus L.): Late Pleistocene connections between Caucasus and Western European populations

The Common hamster (Cricetus cricetus) is one of the most endangered mammals in Western and Central Europe. Its genetic diversity in Russia and Kazakhstan was investigated for the first time. The analysis of sequences of an mtDNA control region and cytochrome b gene revealed at least three phylogenetic lineages. Most of the species range (approximately 3 million km2), including central Russia, Crimea, the Ural region, and northern Kazakhstan), is inhabited by a single, well-supported phylogroup, E0. Phylogroup E1, previously reported from southeastern Poland and western Ukraine, was first described from Russia (Bryansk Province). E0 and E1 are sister lineages but both are monophyletic and separated by considerable genetic distance. Hamsters inhabiting Ciscaucasia represent a separate, distant phylogenetic lineage, named “Caucasus”. It is sister to the North phylogroup from Western Europe and the contemporary phylogeography for this species is discussed considering new data. These data enabled us to develop a new hypothesis to propose that in the Late Pleistocene, the continuous range of the Common hamster in the northern Mediterranean extended from the central and southern parts of modern France to the Caucasus; however, its distribution was subsequently interrupted, likely because of climate change.

Occurrence and Distribution of Mitochondrial Lineages of Gray Whales (Eschrichtius robustus) in Russian Far Eastern Seas

This article presents data on frequencies of mitotypes (control region and cytochrome b and ND2 genes) in groups of Gray Whales found off the Chukotka Peninsula, Koryak coast, eastern Kamchatka and Sakhalin Island. From north to south the number of mitotypes decreased dramatically, but mitotypes which were predominant in the south were the same as ones also abundant in northern samples. For the control region sequences only, our data and data presented in the literature suggest that breeding areas in Baja California may include diversity of both distant groups of mitochondrial lineages known for the species. On the other hand, the same control region sequences may be found in different mitochondrial genomes, and so conclusions based on this mtDNA fragment only may be incorrect.

Mitochondrial Lineages of the Beluga Whale Delphinapterus leucas in the Russian Arctic

The data on mtDNA sequences of the beluga whale (Delphinapterus leucas) from the central Eastern Arctic as well as coastal waters of the Chukchi Peninsula and different parts of the White Sea are presented and analyzed for the first time. Certain sequences found in the region form a separate phylogenetic clade. The distinctness of composition of maternal lineages found for the White Sea is noted. However, the set of sequences found in the Russian Arctic in whole cannot be characterized as region-specific.

Abundance estimate of the Okhotsk Sea population of the bowhead whale (Balaena mysticetus Linnaeus, 1758)

Abundance of 388 ± 108 whales for the Okhotsk Sea bowhead whale population based on individual genotyping was estimated using the capture–recapture method for the open population model. The data demonstrate that this endangered population shows no signs of recovery.

The role of symbiotic bacteria living in specific complexes in mouth corners in the regulation of the normal vital activity of the dwarfhamster Phodopus campbelli.

External skin glands of mammals, including rodents, are a suitable place for the formation of bacterial flora complexes. However, the importance of this flora for the animal host is often unclear. It is generally believed that the main role of specific skin glands and their secretions is their involvement in various aspects of chemical communication, and the activity of the bacterial flora makes an important contribution to the formation of the specific odor of the gland secretion [1, 2, etc.]. However, evidence is being accumulated that suggests a much more complex and multifold role of the bacteria that are present in specific skin glands. For example, the glandula nictitans (Harder’s gland) of the Mongolian gerbil may be involved in thermoregulation [3]. It is assumed that some specific skin glands and their secretes may be involved in local immunity in bats and ungulates [4, 5]. Specific glandular complexes located in the mouth corners of the dwarfhamster Phodopus campbelli and Ph. sungorus are an excellent example of a special function of specific skin glands and their symbiotic microflora. These unique structures are additional epidermal sacculi located between the skin of the cheek and the tissues of the cheek pouch, and each of them is surrounded with the glandular field of the cheek pouch. The glandular complexes are filled with a whitish yellow secretion with a specific, sharp odor. This secretion consists of the metabolic products of symbiotic bacteria growing in the additional sacculi and using the rapidly desquamating epidermal layer of the sacculus internal walls as a substrate and the secretion of sebaceous glands running along hairs from the surrounding glandular field [6]. The bacterial flora of the secretion mainly consists of two forms, the cocci Streptococcus faecium and the thin, immobile rods Microbacterium oxydans , which together account for 82–96% of the all bacteria found in the additional sacculi. The secretion also contains small amounts of Streprococcus salivarius , as well as Brevibacterium and Bacillus [6, 7]. The activity of this bacterial flora largely determines the high amylolytic and proteolytic activities of the secretion of the specific glandular complex ( 0.18 ± 0.01 a.u. and 1.5 ± 0.4 p.u.; the latter value is comparable to that observed in the stomach [8]). In addition, this secretion is a source of vitamin Ç 12 [6]. The secretion of the glandular complex is known to be an important factor of chemical communication in hamsters [6, 9, 10]. However, its main function is different. Experiments with adult Ph. campbelli demonstrated an important role of the secretion of the specific glandular complex in normalizing digestion, maintaining the immune status, and ultimately in survival of the animals [6, 11]. The secretion of the glandular complex is even more important for normal growth and development of the young [6, 12, 13]. However, although the results of these studies have demonstrated the importance of this secretion for normalizing many vital functions in hamsters, they have left many aspects of the mechanisms of its effect unexplained. It is unknown, e.g., whether the absence of the secretion can be compensated for by adding bacterial preparations usually used for treating dysbacterioses. Dry Bifidumbacterinum is one of these preparations. It suppresses the development of many putrefactive and pathogenic microorganisms, synthesizes vitamins B and K, and promotes carbohydrate digestion. The purpose of this study was to compare the effects of the secretion of the specific glandular complex and Bifidumbacterinum on the survival, growth, and development of young hamsters. We used Ph. campbelli kept in the vivarium of the Severtsov Institute of Ecology and Evolution under standard conditions. All young hamsters used in the experiments were raised in normal family groups consisting of the father, the mother, and their offspring. The control group comprised 27 male and 20 female young hamsters from 17 litters. The young from the control group were able to obtain the secretion of the GENERAL BIOLOGY