Igor Ya. Dubey

Can DNA-binding proteins of replisome tautomerize nucleotide bases? Ab initio model study

Ab initio quantum-chemical study of specific point contacts of replisome proteins with DNA modeled by acetic acid with canonical and mutagenic tautomers of DNA bases methylated at the glycosidic nitrogen atoms was performed in vacuo and continuum with a low dielectric constant (ϵ ∼ 4) corresponding to a hydrophobic interface of protein–nucleic acid interaction. All tautomerized complexes were found to be dynamically unstable, because the electronic energies of their back-reaction barriers do not exceed zero-point vibrational energies associated with the vibrational modes whose harmonic vibrational frequencies become imaginary in the transition states of the tautomerization reaction. Additionally, based on the physicochemical arguments, it was demonstrated that the effects of biomolecular environment cannot ensure dynamic stabilization. This result allows suggesting that hypothetically generated by DNA-binding proteins of replisome rare tautomers will have no impact on the total spontaneous mutation due to the low reverse barrier allowing a quick return to the canonical form.

Calculating Helix-to-Coil Transitions of Duplexes Formed by Phenazine-Conjugated Oligonucleotide, Using Flourescence Melting Data

A novel intercalating phenazine derivative (Pzn) was covalently linked to the 3′-end of decathymidylate via a ribose residue of the dye. A fluorescence technique was used to study double helix formation by this conjugate with poly(rA) in aqueous solutions of neutral pH, at the presence of 0.1 and 1 M sodium ions. Proportionality between thermally induced changes in the fluorescence intensity of the free conjugate and bound one was revealed, that made it possible to calculate the helix-to-coil transition from fluorescence melting data using a simple equation. The transition curves were found to be in well conformity with those constructed from absorption measurements. It was shown that the attachment of Pzn significantly enhanced the stability of poly(rA) · (dT)10 duplex due to intercalation of the dye chromophore into the adenine strand. The temperature of half-dissociation was increased by 12°C, and the stabilizing increment of standard free energy was 3.2–3.6 kcal/mol at 37°C.

Interaction of a tricationic meso-substituted porphyrin with guanine-containing polyribonucleotides of various structures

The interaction of a tricationic water-soluble meso-(N-methylpyridinium)-substituted porphyrin, TMPyP3+, derived from classic TMPyP4, with double-stranded poly(G)  ⋅  poly(C) and four-stranded poly(G) polyribonucleotides has been studied in aqueous buffered solutions, pH 6.9, of low and near-physiological ionic strengths in a wide range of molar phosphate-to-dye ratios (P/D). To clarify the binding modes of TMPyP3+ to biopolymers various spectroscopic techniques, including absorption and polarized fluorescence spectroscopy, Raman spectroscopy, and resonance light scattering, were used. As a result, two competitive binding modes were revealed. In solution of low ionic strength outside binding of the porphyrin to the polynucleotide backbone with self-stacking prevailed at low P/D ratios (P/D  <  3.5). It manifested itself by the substantial quenching of porphyrin fluorescence. Also the formation of large-scale porphyrin aggregates was observed near the stoichiometric binding ratio. The spectral changes observed at P/D  >  30 including emission enhancement were supposed to be caused by the embedding of partially stacked porphyrin J-dimers into the polymer groove. TMPyP3+ binding to poly(G) induced a fluorescence increase 2.5 times as large as that observed for poly(G)  ⋅  poly(C). In solution of near-physiological ionic strength the efficiency of external porphyrin binding was reduced substantially due to the competitive binding of Na+ ions with the polymer backbone. The spectroscopic characteristics of porphyrin bound to polynucleotides at different conditions were compared with those for free porphyrin.

Fluorescent Studies on Cooperative Binding of Cationic Pheophorbide-a Derivative to Polyphosphate

The cooperative binding of a novel water‐soluble cationic derivative of pheophorbide‐a (CatPheo‐a) to inorganic polyphosphate (PPS) in buffered aqueous solutions was studied by means of polarized fluorescence spectroscopy in a wide range of molar phosphate‐to‐dye ratios (P/D). Under low P/D values, CatPheo‐a forms extended stacking associates on the PPS matrix, while under high P/D the dye binds to PPS in the dimer form. The CatPheo‐a self‐association is accompanied by 40‐fold dye fluorescence quenching and a substantial increase in the fluorescence polarization degree. The fluorescent titration data were used for determination of cooperative binding parameters by Schwarzs method.

A new mechanism of post-transfer editing by aminoacyl-tRNA synthetases: catalysis of hydrolytic reaction by bacterial-type prolyl-tRNA synthetase

Aminoacyl tRNA synthetases are enzymes that specifically attach amino acids to cognate tRNAs for use in the ribosomal stage of translation. For many aminoacyl tRNA synthetases, the required level of amino acid specificity is achieved either by specific hydrolysis of misactivated aminoacyl-adenylate intermediate (pre-transfer editing) or by hydrolysis of the mischarged aminoacyl-tRNA (post-transfer editing). To investigate the mechanism of post-transfer editing of alanine by prolyl-tRNA synthetase from the pathogenic bacteria Enterococcus faecalis, we used molecular modeling, molecular dynamic simulations, quantum mechanical (QM) calculations, site-directed mutagenesis of the enzyme, and tRNA modification. The results support a new tRNA-assisted mechanism of hydrolysis of misacylated Ala-tRNAPro. The most important functional element of this catalytic mechanism is the 2′-OH group of the terminal adenosine 76 of Ala-tRNAPro, which forms an intramolecular hydrogen bond with the carbonyl group of the alanine residue, strongly facilitating hydrolysis. Hydrolysis was shown by QM methods to proceed via a general acid-base catalysis mechanism involving two functionally distinct water molecules. The transition state of the reaction was identified. Amino acid residues of the editing active site participate in the coordination of substrate and both attacking and assisting water molecules, performing the proton transfer to the 3′-O atom of A76.

Spectroscopic Studies on Binding of Porphyrin-Phenazine Conjugate to Four-Stranded Poly(G)

Binding of a novel cationic porphyrin–imidazophenazine conjugate, TMPyP3+–ImPzn, to four-stranded poly(G) was investigated in aqueous solutions of neutral pH under near physiological ionic conditions using absorption, polarized fluorescent spectroscopy and fluorescence titration techniques. In absence of the polymer the conjugate folds into stable internal heterodimer with stacking between the porphyrin and phenazine chromophores. Binding of TMPyP3+–ImPzn to poly(G) is realized by two competing ways. At low polymer-to-dye ratio (P/D < 6) outside electrostatic binding of the cationic porphyrin moieties of the conjugate to anionic polynucleotide backbone with their self-stacking is predominant. It is accompanied by heterodimer dissociation and distancing of phenazine moieties from the polymer. This binding mode is characterized by strong quenching of the conjugate fluorescence. Increase of P/D results in the disintegration of the porphyrin stacks and redistribution of the bound conjugate molecules along the polymer chain. At P/D > 10 another binding mode becomes dominant, embedding of TMPyP3+–ImPzn heterodimers into poly(G) groove as a whole is occurred.

Quantum Chemical Approaches in Modeling the Structure of DNA Quadruplexes and Their Interaction with Metal Ions and Small Molecules

Certain guanine-rich DNA and RNA sequences can fold into unique biologically significant high-order structures called G-quadruplexes (G4) formed by stacked arrays of guanine quartets connected by non-canonical hydrogen bonds. Novel anticancer strategy is based on the use of organic molecules that specifically target quadruplex structures present in telomeres and some other regions of the genome. We provide a brief overview of the structural features of quadruplex nucleic acids and main mechanisms of G4-ligand interaction. Current methods for the molecular modeling of quadruplex DNA structures and their ligand binding are discussed in the review. We mainly focus on quantum chemical computational approaches to model the interaction of G4 DNA and its structural elements with metal cations and small molecules, including hybrid QM/MM approaches.

Selective Recognition of Bifunctional Molecules by Synthetic Polymers Prepared by Covalent Molecular Imprinting

Affinity polymeric adsorbents useful for the separation of compounds which are derivatives of phenols, heterocycles and other compounds containing two polar moieties were prepared by a covalent imprinting approach. Such separation, for example, would facilitate the analytical detection and quantification of each individual compound especially when present in complex sample matrix. The synthetic method, utilised for the preparation of the polymers, is based on co-polymerization of diacrylate esters of hydroxyphenols (catechol, resorcinol and hydroquinone) with an appropriate cross-linker followed by alkaline hydrolysis of the esters and release of the corresponding phenol. The resulting swellable materials contain cavities with adjustable size and orientation of two carboxylic groups suited for the binding of molecules with appropriate size and complementary orientation of polar groups. In contrast to conventional MIPs the synthesized polymers have selectivity not only for the phenolic templates, but also for a group of compounds with suitable orientations of polar functionalities, such as aromatic nitrogen, amino or hydroxyl groups. Polymers demonstrated different affinity to ortho-, meta- and para-isomers of hydroxyphenols, hydroxypyridines and diazine heterocycles.

Binding of Metallated Porphyrin-Imidazophenazine Conjugate to Tetramolecular Quadruplex Formed by Poly(G): a Spectroscopic Investigation.

The binding of telomerase inhibitor ZnTMPyP3+–ImPzn, Zn(II) derivative of tricationic porphyrin–imidazophenazine conjugate, to tetramolecular quadruplex structure formed by poly(G) was studied in aqueous solutions at neutral pH and near physiological ionic strength using absorption and polarized fluorescent spectroscopy techniques. Three binding modes were determined from the dependences of the fluorescence intensity and polarization degree for the porphyrin and phenazine moieties of the conjugate on molar polymer-to-dye ratio (P/D). The first one is outside electrostatic binding of positively charged porphyrin fragments to anionic phosphate groups of the polymer which prevails only at very low P/D values and manifests itself by substantial fluorescence quenching. It is suggested that the formation of externally bound porphyrin dimers occurs. The other two binding modes observed at high P/D are embedding of the ZnTMPyP3+ moiety into the groove of poly(G) quadruplex accompanied by more than 3-fold enhancement of the conjugate emission, and simultaneous intercalation of the phenazine fragment between the guanine bases accompanied by the increase of its fluorescence polarization degree up to 0.25. Thus Zn(II) conjugate seems to be promising ligand for the stabilization of G-quadruplex structures since porphyrin binding to poly(G) is strengthened by additional intercalation of phenazine moiety.

Luminescence of telomeric fragments of DNA macromolecule

ABSTRACT Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences.