Ikuma Kato

Epithelioid angiomyolipoma of the kidney

Epithelioid angiomyolipoma (eAMLoma) is an uncommon renal mesenchymal tumor with malignant potential and is frequently associated with tuberous sclerosis (TSC). It is composed of polygonal large‐sized tumor cells arranged in an epithelioid manner. Differential diagnosis from renal cell carcinoma (RCC) is often challenging because of its epithelioid morphology. Herein is reported three cases of eAMLoma, involving one in a 28‐year‐old man with TSC and two in women without TSC (34 and 62 years of age, respectively). The male TSC patient had microscopic conventional AMLomas in the same kidney. All patients were positive for melanoma (reactive with HMB45 antibody, and positive for melan A, tyrosinase and microphthalmia transcription factor) and smooth muscle markers (positive for α‐smooth muscle‐specific actin), but not for epithelial markers (cytokeratin, epithelial membrane antigen). In particular, the translocation RCC is an important differential diagnostic candidate, in terms of the positive reaction with HMB45 and morphological similarity. The present tumor samples did not show any reactivity for transcription factor binding to IGHM enhancer 3 or transcription factor EB, which excluded the possibility of translocation RCC. The possibility of eAMLoma should be evaluated as a diagnostic candidate, especially in cases of renal tumors (i) in young patients; (ii) associated with TSC; or (iii) with an epithelioid morphology and a high nuclear grade.

Pulmonary Neoplasms in Patients with Birt-Hogg-Dubé Syndrome: Histopathological Features and Genetic and Somatic Events

Birt-Hogg-Dubé syndrome (BHD) is an inherited disorder caused by genetic mutations in the folliculin (FLCN) gene. Individuals with BHD have multiple pulmonary cysts and are at a high risk for developing renal cell carcinomas (RCCs). Currently, little information is available about whether pulmonary cysts are absolutely benign or if the lungs are at an increased risk for developing neoplasms. Herein, we describe 14 pulmonary neoplastic lesions in 7 patients with BHD. All patients were confirmed to have germline FLCN mutations. Neoplasm histologies included adenocarcinoma in situ (n = 2), minimally invasive adenocarcinoma (n = 1), papillary adenocarcinoma (n = 1), micropapillary adenocarcinoma (n = 1), atypical adenomatous hyperplasia (n = 8), and micronodular pneumocyte hyperplasia (MPH)-like lesion (n = 1). Five of the six adenocarcinoma/MPH-like lesions (83.3%) demonstrated a loss of heterozygosity (LOH) of FLCN. All of these lesions lacked mutant alleles and preserved wild-type alleles. Three invasive adenocarcinomas possessed additional somatic events: 2 had a somatic mutation in the epidermal growth factor receptor gene (EGFR) and another had a somatic mutation in KRAS. Immunohistochemical analysis revealed that most of the lesions were immunostained for phospho-mammalian target of rapamycin (p-mTOR) and phospho-S6. Collective data indicated that pulmonary neoplasms of peripheral adenocarcinomatous lineage in BHD patients frequently exhibit LOH of FLCN with mTOR pathway signaling. Additional driver gene mutations were detected only in invasive cases, suggesting that FLCN LOH may be an underlying abnormality that cooperates with major driver gene mutations in the progression of pulmonary adenocarcinomas in BHD patients.

Fluorescent and chromogenic in situ hybridization of CEN17q as a potent useful diagnostic marker for Birt-Hogg-Dube syndrome-associated chromophobe renal cell carcinomas.

Birt-Hogg-Dubé syndrome (BHD) is a familial disorder associated with a germline mutation of FLCN that is a tumor suppressor gene. Patients with BHD have high risks for developing multiple renal cell carcinomas (RCCs). The frequent histological types are hybrid oncocytic/chromophobe tumors (HOCTs) and chromophobe RCCs. The morphology of HOCTs could alert pathologists to the possibility of BHD. On the other hand, chromophobe RCCs occurring in BHD patients demonstrate positive immunostaining for cytokeratin-7, CD82, and Ksp-cadherin similar to their sporadic counterparts. Highly reliable markers for BHD-associated chromophobe RCCs have not been identified. In the present study, we analyzed the state of chromosome 17 in 18 renal tumors composed of 8 chromophobe RCCs, 7 HOCTs, and 3 papillary RCCs obtained from BHD patients using fluorescent and chromogenic in situ hybridization probes for the centromeric region of chromosome 17 long arm. All chromophobe RCCs and HOCTs were disomic except for 1 chromophobe RCC that showed monosomy. On the other hand, 12 of 14 sporadic chromophobe RCCs were monosomic (P = .0008). The state of chromosomes 2 and 6 were also statistically different (P = .0074 and P = .0007, respectively). Three BHD-associated papillary RCCs demonstrated either trisomy (n = 2) or disomy (n = 1). Three of 5 sporadic papillary RCCs showed trisomy. The results indicate that fluorescent and chromogenic in situ hybridization of the centromeric region of chromosome 17 long arm should be a potent useful marker for chromophobe RCCs in patients who have not been diagnosed with BHD and thereby help to determine whether the cases should be considered for genetic testing.

Angiofibroma of soft tissue with fibrohistiocytic features and intratumor genetic heterogeneity of NCOA2 gene rearrangement revealed by chromogenic in situ hybridization: A case report

Angiofibroma of soft tissue is a recently described soft tissue tumor that is characterized by fibroblastic spindle tumor cells with arborizing capillary proliferation. Cytogenetically, it harbors a specific fusion gene involving the nuclear receptor coactivator 2 (NCOA2) gene. We report here additional new pathological and cytogenetic features. A soft tissue tumor in the left thigh of 73‐year‐old female was investigated. Microscopically, histiocytoid tumor cells were scattered in an edematous background with branching capillary proliferation. Immunohistochemically, we identified that the tumor cells were positive for histiocytic markers such as CD68 and CD163. Rearrangement of the NCOA2 gene was detected successfully by chromogenic in situ hybridization; however, abnormal signal patterns were observed in only a small subset of tumor cells. Unlike typical tumors with bland spindle cells, the present tumor needs to be distinguished from myxoid, dendritic and clear cell tumors. This case may suggest that angiofibroma of soft tissue is not in the center of the fibroblastic/myofibroblastic tumor group, but rather shows a fibrohistiocytic nature. We also found intratumor genetic heterogeneity, which is uncommon for a translocation‐associated tumor. Therefore, careful evaluation is required to detect the gene rearrangement in this tumor entity.

Giant cell tumours of bone treated with denosumab: histological, immunohistochemical and H3F3A mutation analyses

Denosumab, a human monoclonal antibody directed against the receptor activator of nuclear factor‐κB ligand (RANKL), is a therapeutic agent for giant cell tumour of bone (GCTB). Although some studies have reported that denosumab shrinks tumours and induces bone formation, the actual effects of RANKL suppression on GCTB remain unclear. A mutation in the H3 histone family member 3A gene (H3F3A) was recently identified as a genetic signature for GCTB. The aim of this study was to investigate the histopathological features and H3F3A mutation status of GCTBs treated with denosumab.

FOSL1 immunohistochemistry clarifies the distinction between desmoplastic fibroblastoma and fibroma of tendon sheath.

Although desmoplastic fibroblastoma (DFB) and fibroma of tendon sheath (FTS) are well‐established entities, they may show overlapping clinicopathological features. In addition, cytogenetic data showing a shared 11q12 rearrangement in a small number of cases suggest a close link between these entities. A recent microarray study revealed up‐regulation of FOSL1 mRNA in DFBs with 11q12 rearrangement. The aim of this study was to clarify the relationship between DFB and FTS.

Angiotensin II Type 1 Receptor-associated Protein Inhibits Angiotensin II-induced Insulin Resistance with Suppression of Oxidative Stress in Skeletal Muscle Tissue

Enhancement of AT1 receptor-associated protein (ATRAP) in adipose tissue improves high fat diet (HFD)-induced visceral obesity and insulin resistance, and suppresses adipose oxidative stress. However, HFD loading is not a direct stimulatory factor for AT1 receptor. In the present study, we investigated the effect of chronic, low-dose angiotensin II (Ang II) stimulation on glucose and lipid metabolism in mice and functional role of ATRAP. ATRAP expression was higher in adipose tissue (5–10-fold) and skeletal muscle tissue (approximately 1.6-fold) in ATRAP transgenic (TG) mice compared with wild-type (WT) mice. After Ang II infusion, insulin sensitivity was impaired in WT mice, but this response was suppressed in TG mice. Unexpectedly, Ang II infusion did not affect the adipose tissue profile in WT or TG mice. However, in skeletal muscle tissue, Ang II stimulus caused an increase in oxidative stress and activation of p38 MAPK, resulting in a decrease in glucose transporter type 4 expression in WT mice. These responses were suppressed in TG mice. Our study suggests that Ang II-induced insulin resistance is suppressed by increased ATRAP expression in skeletal muscle tissue. Hyperactivity of AT1 receptor could be related to formation of insulin resistance related to metabolic syndrome.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase: Histopathology of HLRCC

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32‐year‐old man who underwent nephrectomy for treatment of a solid‐cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high‐grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3’ end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT‐PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the “second hit” of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Intracranial epidermoid cyst with proliferative folliculosebaceous epithelium: Report of a rare case and discussion on pathogenesis: Intracranial epidermoid cyst

Intracranial epidermoid cysts are rarely known to increase in size over a brief period. While malignant transformations of epidermoid cyst have been previously described, no reports to date have described rapid proliferation accompanied by mature hair follicles and sebaceous glands without malignant transformations. The present case involved a 71‐year‐old man who visited a local physician with disturbance of equilibrium. A mass lesion was detected at the left cerebellopontine angle and was subsequently removed. Histopathological diagnosis of this lesion was as an epidermoid cyst. Seventeen years after this initial surgery, worsened left hypoacusis, disorientation, eating disorder and gait disturbance appeared, and the patient visited the physician again. Local recurrence of the lesion was observed, and the patient was referred to our hospital for its removal. Intraoperative findings revealed a pearly white tumor, histopathologically diagnosed as an epidermoid cyst. Three years later, local recurrence was observed, and the cyst was again removed. Intraoperative findings revealed a partially pearly white tumor similar to the tumor observed during the second surgery, but the majority of the tumor was non‐shiny, ochre‐colored and suckable. Histopathological diagnosis was an epidermoid cyst with an epidermis‐like structure. Postoperative activities of daily living were independent thereafter, but from March of the following year, he began to experience increasing difficulty in walking and subsequently visited our hospital again. Tumor recurrence was observed and was removed again in November of the same year. Intraoperative findings revealed a tumor that was primarily ochre‐colored, non‐shiny, brittle and suckable. The histopathological diagnosis was folliculosebaceous epithelial proliferative lesion accompanied by an epidermis‐like epithelium and a differentiation into hair follicles and sebaceous gland,s and the tumor was determined to be an epidermoid cyst with proliferative folliculosebaceous epithelium.

Hereditary leiomyomatosis and renal cell cancer without cutaneous manifestations in two Japanese siblings

Hereditary leiomyomatosis and renal cell cancer is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis, and an aggressive type 2 papillary renal cell carcinoma. The disease is caused by a germline mutation in the fumarate hydratase gene. We report a familial hereditary leiomyomatosis and renal cell cancer in two siblings. A 34‐year‐old woman underwent nephrectomy for treatment of a renal cell carcinoma. The patients sister had been diagnosed with renal cell carcinoma at 28 years‐of‐age and died of the disease. Neither sister had apparent skin tumors. Histopathology of the renal cell carcinomas of the siblings showed tubulocystic and papillary architectures with high nuclear grades. Immunostaining showed no fumarate hydratase expression in either tumor. Genomic DNA sequencing of the patient showed a germline mutation in the fumarate hydratase gene (c.675delT). Although there is no epidemiological information on Asian hereditary leiomyomatosis and renal cell cancer, physicians should be aware that typical cutaneous leiomyomatosis might not always be present in patients with hereditary leiomyomatosis and renal cell cancer.