Inka Praulich

Mitotic recombination and compound-heterozygous mutations are predominant NF1-inactivating mechanisms in children with juvenile myelomonocytic leukemia and neurofibromatosis type 1.

Children with neurofibromatosis type 1 (NF-1), being constitutionally deficient for one allele of the NF1 gene, are at greatly increased risk of juvenile myelomonocytic leukemia (JMML). NF1 is a negative regulator of RAS pathway activity, which has a central role in JMML. To further clarify the role of biallelic NF1 gene inactivation in the pathogenesis of JMML, we investigated the somatic NF1 lesion in 10 samples from children with JMML/NF-1. We report that two-thirds of somatic events involved loss of heterozygosity (LOH) at the NF1 locus, predominantly caused by segmental uniparental disomy of large parts of chromosome arm 17q. One-third of leukemias showed compound-heterozygous NF1-inactivating mutations. A minority of cases exhibited somatic interstitial deletions. The findings reinforce the emerging role of somatic mitotic recombination as a leukemogenic mechanism. In addition, they support the concept that biallelic NF1 inactivation in hematopoietic progenitor cells is required for transformation to JMML in children with NF-1.

Patient-specific analysis of FLT3 internal tandem duplications for the prognostication and monitoring of acute myeloid leukemia.

Internal tandem duplications (ITDs) of the fms‐like tyrosine kinase 3 ( FLT3) gene occur in 13–35% of patients with acute myeloid leukemia (AML). FLT3‐ITD is associated with poor clinical outcome and is an indication for allogeneic stem cell transplantation (allo‐SCT).

Constitutional trisomy 8p11.21-q11.21 mosaicism: a germline alteration predisposing to myeloid leukaemia

Juvenile myelomonocytic leukaemia (JMML) is a unique myeloproliferative disorder of early childhood. Frequently, mutations in NRAS, KRAS, PTPN11, NF1 or CBL are found in these patients. Monosomy 7 is the most common cytogenetic aberration. To identify submicroscopic genomic copy number alterations, 20 JMML samples were analysed by comparative genomic hybridization. Ten out of 20 samples displayed additional submicroscopic alterations. In two patients, an almost identical gain of chromosome 8 was identified. In both patients, fluorescence in situ hybridization confirmed a constitutional partial trisomy 8 mosaic (cT8M). A survey on 27 cT8M patients with neoplasms showed that 21 had myeloid malignancies, and five of these had a JMML. Notably, the region gained in our cases is the smallest gain of chromosome 8 reported in cT8M cases with malignancies so far. Our results dramatically reduce the critical region to 8p11.21q11.21 harbouring 31 protein coding genes and two non‐coding RNAs, e.g. MYST3, IKBKB, UBE2V2, GOLGA7, FNTA and MIR486– a finding with potential implications for the role of somatic trisomy 8 in myeloid malignancies. Further investigations are required to more comprehensively determine how constitutional partial trisomy 8 mosaicisms may contribute to leukaemogenesis in different mutational subtypes of JMML and other myeloid malignancies.

Clonal heterogeneity in childhood myelodysplastic syndromes--challenge for the detection of chromosomal imbalances by array-CGH.

To evaluate whether copy number alterations (CNAs) are present that may contribute to disease development and/or progression of childhood myelodysplastic syndromes (MDS), 36 pediatric MDS patients were analyzed using array‐based comparative genome hybridization (aCGH). In addition to monosomy 7, the most frequent chromosome aberration in childhood MDS, novel recurrent CNAs were detected. They included a loss of 3p14.3–p12.3, which contains the putative tumor suppressor gene FHIT, a loss of 7p21.3–p15.3, a loss of 9q33.3–q34.3 (D184) and microdeletions in 17p11.2, 6q23 containing MYB, and 17p13 containing TP53. In this small patient cohort, patients without CNA, patients with monosomy 7 only and patients with one CNA in addition to monosomy 7 did not differ in their survival. As expected, all patients with complex karyotypes, including two patients with deletions of TP53, died. A challenge inherent to aCGH analysis of MDS is the low percentage of tumor cells. We evaluated several approaches to overcome this limitation. Genomic profiles from isolated granulocytes were of higher quality than those from bone marrow mononuclear cells. Decreased breakpoint calling stringency increased recognition of CNAs present in small clonal populations. However, further analysis using a custom‐designed array showed that these CNAs often did not confirm the findings from 244k arrays. In contrast, constitutional CNVs were reliably detected on both arrays. Moreover, aCGH on amplified DNA from distinct myeloid clusters is a new approach to determine CNAs in small subpopulations. Our results clearly emphasize the need to verify array‐CGH results by independent methods like FISH or quantitative PCR.

A rare case of t(11;22) in a mantle cell lymphoma like B-cell neoplasia resulting in a fusion of IGL and CCND1: case report

The chromosomal translocation (11;14)(q13;q32) rearranging the locus for cyclin D1 (CCND1) to that of the immunoglobulin heavy chain (IGH) can be found in virtually all cases of mantle cell lymphoma (MCL), while other CCND1 translocations are extremely rare. As CCND1 overexpression and activation is a hallmark of MCL it is regarded as a central biological mechanism in the development and maintenance of this disease.Here we present a patient initially diagnosed with chronic lymphocytic leukemia (CLL) where chromosome banding analysis revealed, among other aberrations, a translocation (11;22)(q13;q11.2). We show by fluorescence in situ hybridization (FISH) analysis that on chromosome 22 the immunoglobulin light chain lambda (IGL) is involved in this cytogenetic aberration. Additionally, we demonstrate the resulting overexpression of CCND1 on the RNA and protein level, thereby consolidating the new diagnosis of a MCL-like B-cell neoplasia. Summing up, we described a rare case of t(11;22)(q13;q11.2) in a MCL-like neoplasia and showed that this aberration leads to an overexpression of CCND1 which is regarded as a key biological feature in MCL. This case underlines the importance of cytogenetic analyses especially in atypical cases of B cell lymphomas.

Mutations in the let-7 binding site - a mechanism of RAS activation in juvenile myelomonocytic leukemia?

Juvenile myelomonocytic leukemia (JMML) is a rare hematologic malignancy in childhood and accounts for less than 3% of all childhood hematologic malignancies. 1 The role of hyperactive RAS in JMML is underlined by the fact that approximately 80% of JMML develop due to gain-of-function mutations in NRAS, KRAS, PTPN11 and SOS1 or homozygous loss-of-function mutations in NF1 or c-CBL. 2-4 These genes are all components of the RAS/ERK signaling network, implicating deregulation of this signaling pathway in JMML pathogenesis. Therefore, it may be speculated that JMML lacking known mutations of genes playing a role in RAS signaling may carry other mutations, which result in activation of this pathway. Recently, germline mi-RNA gene variations were pro posed to affect the expression levels of tumor suppressor or oncogenes and, thereby, familial/hereditary cancer risk. 5 The let-7 mi-RNA family targets many important genes including cell cycle regulators such as CDC25A and CDK6, a number of early embryonic genes including HMGA2, Mlin-41 and IMP-1 and promoters of growth including RAS and C-MYC. In Caenorhabditis elegans let7 mutant seam cells fail to exit the cell cycle and to terminally differentiate, thus demonstrating continuous prolif eration, a hallmark of cancer. 6 Human RAS expression was also shown to be regulated by let-7. 7 Evidence of a role of let-7 in cancer came from the observation that lung tumor tissues display significantly reduced let-7 levels and significantly increased RAS protein levels relative to nor mal lung tissue. 8

Mutation analysis of the HAX1 gene in childhood myelodysplastic syndrome

Childhood myelodysplastic syndromes (MDS) comprise a heterogeneous group of clonal stem cell disorders, characterized by the association of cytopenia and abnormalities of erythroid, myeloid and/or megakaryocytic maturation (Mufti et al, 2008; Niemeyer & Baumann, 2008). The underlying molecular mechanisms leading to the development of these disorders are not known. Accelerated apoptosis of haematopoietic cells is the mechanism generally accepted to cause refractory cytopenia (RC) in MDS (Raza et al, 1995). HAX1 is a member of the Bcl-2 family of apoptosis-regulating proteins with anti-apoptotic properties and may suppress cell death through an interaction with pro-apoptotic proteins (Suzuki et al, 1997; Carlsson et al, 2007). Recently, homozygous mutations within the anti-apoptotic HAX1 gene were found in children with congenital neutropenia (CN) including Kostmann syndrome and other constitutional bone marrow failure syndromes (Klein et al, 2007). Interestingly, these patients often develop clonal myeloid disorders like MDS or acute leukaemia (Freedman & Alter, 2002a,b). Moreover, a recent report described a patient with secondary overt leukaemia in CN caused by homozygous HAX1 mutation (p.Q123fsX4), indicating that HAX1 mutation may increase the risk of malignant transformation (Yetgin et al, 2008). Therefore, we investigated whether acquired HAX1 mutations could also explain the accelerated apoptosis and may constitute a preleukaemic condition in childhood MDS. A total of 22 patients with MDS (16 RC and six advanced MDS) were analyzed for HAX1 mutations (Table I). Approval for participation in the European Working Group on Childhood MDS (EWOG-MDS) study, EWOG-MDS 98, was obtained from the Institutional Review board of each institution taking part in the study. Written informed consent was provided according to the Declaration of Helsinki. DNA was extracted from granulocytes or mononuclear cells derived from blood or bone marrow samples. Mutation analysis was performed by direct sequencing. The seven coding exons of HAX1 (U68566) including the 3¢ UTR were amplified and direct sequencing was carried out using the CEQ DTCS Quick Start kit (Beckman Coulter, Fullerton, CA, USA) and the CEQ 2000XL, DNA Analysis System (Beckman Coulter). Primer sequences were the following: exon 1: forward: cgtctgcgaatggaccactg and reverse: ataagacgtaggggtcaag exon 2: forward: catgagttgatttaatggc and reverse: ccagaaaccacaggttgc exon 3: forward: gagagattaatagagcccaag and reverse actttattagtggtctctcac exon 4: forward: atttcagattggaaggagtc and reverse: aacacacagaacttcagaag exon 5: forward: tggactctttctctcctgc and reverse: cagggcattcgttccctgg exon 6 forward: gaaactgctgagcataacc and exon 7 reverse: gaaaggacttgaaggcctc with annealing temperatures of 58, 53, 56, 53, 60 and 56 C, respectively. Polymerase chain reaction cycling profile was 5 min at 95 C for denaturing, then 35 cycles of: 95 C for 30 s, annealing at the corresponding temperature for 30 s and 72 C for 30 s, followed by 72 C for 7 min. None of the patients had a deleterious HAX1 mutation. The single nucleotide polymorphism (SNP) T > C (rs13796) at position c.159 (S53S) was the only alteration within HAX1, which was found in nine children. The SNP was present in six

Molecular characterization of the rare translocation t(3;10)(q26;q21) in an acute myeloid leukemia patient

BackgroundIn acute myeloid leukemia (AML), the MDS1 and EVI1 complex locus - MECOM, also known as the ecotropic virus integration site 1 - EVI1, located in band 3q26, can be rearranged with a variety of partner chromosomes and partner genes. Here we report on a 57-year-old female with AML who presented with the rare translocation t(3;10)(q26;q21) involving the MECOM gene. Our aim was to identify the fusion partner on chromosome 10q21 and to characterize the precise nucleotide sequence of the chromosomal breakpoint.MethodsCytogenetic and molecular-cytogenetic techniques, chromosome microdissection, next generation sequencing, long-range PCR and direct Sanger sequencing were used to map the chromosomal translocation.ResultsUsing a combination of cytogenetic and molecular approaches, we mapped the t(3;10)(q26;q21) to the single nucleotide level, revealing a fusion of the MECOM gene (3q26.2) and C10orf107 (10q21.2).ConclusionsThe approach described here opens up new possibilities in characterizing acquired as well as congenital chromosomal aberrations. In addition, DNA sequences of chromosomal breakpoints may be a useful tool for unique molecular minimal residual disease target identification in acute leukemia patients.

Array-CGH in childhood MDS.

To study genomic imbalances potentially involved in disease development and/or progression of childhood MDS, array-based comparative genomic hybridization (aCGH) is a helpful tool. Copy number alterations (CNA) of subtle chromosomal regions containing potential candidate genes, e.g., TP53 or RUNX1 can be detected. However, characterizing small and/or heterogeneous tumor subpopulations by high-resolution aCGH within a majority of normal cells is a challenge in MDS and requires validation by independent methods like FISH or quantitative PCR. For the identification of tumor-relevant CNA, the analysis of DNA isolated from purified granulocytes or myeloid populations instead of DNA from whole bone marrow (BM) cells is helpful to overcome some of these limitations.