Iqbal Parwez

Effect of 5-year enalapril therapy on progression of microalbuminuria and glomerular structural changes in type 1 diabetic subjects

A 5-year randomized, double blind, placebo-controlled study was carried out to determine the effect of the angiotensin-converting enzyme (ACE) inhibitor enalapril (E) on the progress of renal function and histology in subjects with type 1 diabetes and microalbuminuria. Seventy three type 1 diabetic patients with BP <140/90 and with persistent albuminuria (AER 20-200 microg/min) and normal renal function were randomly assigned to receive E (n=37) or placebo (n=36). A percutaneous renal biopsy was successfully performed in 69 patients and repeated in 59 patients after 5 years. The mean glomerular volume (MGV), mesangial volume (Vv mes) and glomerular basement membrane thickness (GBMT) were measured histomorphometrically. Before treatment, both groups had similar clinical characteristics, blood pressure, HbA(1c), albumin excretion rate (AER), glomerular filtration rate (GFR), serum creatinine and renal structural damage. Blood pressure was well controlled in both groups. In the patients treated with E, albuminuria decreased significantly (P<0.05) and only 8.1% (3/37) of subjects progressed to clinical albuminuria (AER >300 mg/24 h) compared with 30.5% (11/36) in the placebo group. The E treatment resulted in absolute risk reduction of 22.4 percentage points for the development of clinical albuminuria over a 5-year period (P<0.01). After 5 years of treatment, GBM thickness showed a consistent, though statistically insignificant, increase in the placebo group, whereas it remained stable in the E group. A significant increase in MGV and Vv mes was also observed in the placebo group on completion of the study. The present study indicates that long term therapy with E may decrease or delay the progression of structural glomerular damage in microalbuminuric diabetic subjects without marked hypertension (BP <140/90).

Oral administration of Nigella sativa oil ameliorates the effect of cisplatin on brush border membrane enzymes, carbohydrate metabolism and antioxidant system in rat intestine

Cisplatin (CP) is an effective chemotherapeutic agent that induces gastrointestinal toxicity. Nigella sativa oil (NSO) has been shown to be beneficial in a wide range of gastrointestinal disorders. The present study investigates the possible protective effect of NSO on CP-induced gastrointestinal toxicity. NSO administration (2ml/kg bwt, orally), prior to and following, a single dose CP treatment (6mg/kg bwt. ip), significantly attenuated the CP-induced decrease in brush border membrane (BBM) enzyme activities in intestinal homogenates and BBM vesicles (BBMV). NSO administration also mitigated CP induced alterations in the activities of carbohydrate metabolism enzymes and in the enzymatic and non-enzymatic antioxidant parameters in the intestine. The results suggest that NSO by empowering the endogenous antioxidant system improves intestinal redox and metabolic status and restores BBM integrity in CP treated rats. Histopathological studies supported the biochemical findings. Thus, NSO may help prevent the accompanying gastrointestinal dysfunction in CP chemotherapy.

Analysis of VNTR loci in fish genomes using synthetic oligodeoxyribonucleotide probes

A set of synthetic oligodeoxyribonucleotide (oligo) probes, OAT18, OMS1 and OAT24 carrying the (TGG)6, (GGAT)4 and (GACA)6 repeat motifs, respectively, was used to analyze the variable number tandem repeat (VNTR) loci in the genomes of Oncorhyncus mykiss (rainbow trout; family Salmonidae), Oreochromis mossambicus and Oreochromis niloticus (both tilapia belonging to family Cichlidae). Of all the oligos and enzymes (AluI, MboI, HaeIII and HinfI) used, the OAT18/HaeIII combination was found to be most informative for detecting DNA fingerprinting in rainbow trout, while the OMS1/MboI combination gave the most informative pattern for the Or. niloticus genome. In the rainbow trout genome, all three repeat loci were hypervariable, revealing varying degrees of polymorphism as compared to tilapia genomes. Startlingly, the OAT24 probe did not cross-hybridize with Or. mossambicus and lamprey salmon (Lampertra japonica) although GACA repeats have been reported to be evolutionarily conserved in all eukaryotes studied thus far. Cluster analysis with respect to GGAT repeat loci revealed that Or. niloticus diverged from Or. mossambicus before the separation of On. mykiss, suggesting the relatively recent evolution of these loci in rainbow trout, compared to the tilapia genomes. These highly informative probes will find application in various genetic studies of fishes.

Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Oral administration of thymoquinone mitigates the effect of cisplatin on brush border membrane enzymes, energy metabolism and antioxidant system in rat intestine

Cisplatin (CP) is a widely used chemotherapeutic agent that elicits severe gastrointestinal toxicity. Nigella sativa, a member of family Ranunculaceae, is one of the most revered medicinal plant known for its numerous health benefits. Thymoquinone (TQ), a major bioactive component derived from the volatile oil of Nigella sativa seeds, has been shown to improve gastrointestinal functions in animal models of acute gastric/intestinal injury. In view of this, the aim of the present study was to investigate the protective effect of TQ on CP induced toxicity in rat intestine and to elucidate the mechanism underlying these effects. Rats were divided into four groups viz. control, CP, TQ and CP+TQ. Animals in CP+TQ and TQ groups were orally administered TQ (1.5mg/kg bwt) with and without a single intraperitoneal dose of CP (6mg/kg bwt) respectively. The effect of TQ was determined on CP induced alterations in the activities of brush border membrane (BBM), carbohydrate metabolism, and antioxidant defense enzymes in rat intestine. TQ administration significantly mitigated CP induced decline in the specific activities of BBM marker enzymes, both in the mucosal homogenates and in the BBM vesicles (BBMV) prepared from intestinal mucosa. Furthermore, TQ administration restored the redox and metabolic status of intestinal mucosal tissue in CP treated rats. The biochemical results were supported by histopathological findings that showed extensive damage to intestine in CP treated rats and markedly preserved intestinal histoarchitecture in CP and TQ co-treated group. The biochemical and histological data suggest a protective effect of TQ against CP-induced gastrointestinal damage. Thus, TQ may have a potential for clinical application to counteract the accompanying gastrointestinal toxicity in CP chemotherapy.

Effect of chromium picolinate and melatonin either in single or in a combination in high carbohydrate diet-fed male Wistar rats

This study is designed to know the effects of chromium picolinate (CrPic) and melatonin (Mel) each alone and in a combination on high carbohydrate diet-fed (HCD-fed) male Wistar rats that exhibit insulin resistance (IR), hyperglycemia, and oxidative stress. Wistar rats have been categorized into five groups. Each group consisted of six male Wistar rats, control rats (group I), HCD (group II), HCD + CrPic (group III), HCD + Mel (group IV), and HCD + CrPic + Mel (group V). Insignificant differences were observed in serum levels of superoxide dismutase, nitric oxide, and zinc in group III, group IV, and group V when each group was compared with group II rats respectively. Significant differences were observed in group III, group IV, and group V when each group was compared with group II in homeostasis model assessment-estimated IR (P < 0.05, <0.0.05, <0.05), and in the levels of blood glucose (P < 0.05, <0.0.05, <0.05), total cholesterol (P < 0.05, <0.001, <0.001), triacylglycerols (<0.05, <0.001, <0.001), high density lipoprotein cholesterol (P < 0.05, <0.001, <0.001), malondialdehyde (P < 0.05, <0.05, <0.001), catalase (P <0.05, <0.05, <0.05), glutathione (P < 0.05, <0.05, <0.05), Mel (P < 0.05, <0.05, <0.001), and copper (P < 0.05, <0.05, < 0.001). In view of these results, HCD-fed male Wistar rats that are destined to attain IR and T2DM through diet can be prevented by giving CrPic and Mel administration in alone or in a combination.

Relevance of empirical optimization for cross-linking DNA by using an ordinary ultraviolet-light source

For cross-linking DNA onto nitrocellulose or nylon membranes by using ordinary ultraviolet (UV) light, empirical optimization with respect to exposure time is crucial for obtaining complete hybridization signals. Longer than optimal UV exposure reduces the signal intensity particularly in the larger DNA fragments, whereas shorter exposure due to insufficient immobilization produces incomplete signals. Relevance of using ordinary source of UV light with respect to fixing DNA on a large number of circular filters during library screening is discussed.

Culture-based screening of aerobic microbiome in diabetic foot subjects and developing non-healing ulcers

The study was carried on diabetic foot patients to deduce clinical attributes, the occurrence of the range of aerobic microbial flora and to assess their comparative in vitro susceptibility to the customarily used antimicrobials. We also studied the potential risk factors involved in the development of non-healing ulcers. A total of 87 organisms were isolated from 70 specimens, including Escherichia coli (19.5%) among the Gram-negative and Staphylococcus aureus (18.4%) among the Gram-positive as the predominant aerobes explored. Pseudomonas aeruginosa and E. coli were predominant isolates of non-healing ulcers. The antimicrobial sensitivity pattern revealed that vancomycin (100%) and amikacin (90.4%) exhibited highest sensitivity to Gram-positive cocci, while all strains of P. aeruginosa were sensitive toward imipenem (100%). The prevalent uncontrolled glycemic status, altered lipid spectra, the existence of neuropathy, and peripheral vascular disease, suggested predisposition toward the development of non-healing lesions. The study has underlined the need for continuous surveillance of bacteria and their antimicrobial sensitivity blueprints to provide the basis for empirical therapy and to minimize the risk of complications. Further, stringent clinical evaluation, and medical history will help in revealing the risk of developing non-healing status in diabetic foot ulcers.

Molecular and culture based assessment of bacterial pathogens in subjects with diabetic foot ulcer

INTRODUCTION Expeditious and precise discerning of bacterial pathogens is a fundamental grail, of clinical diagnostic microbiology. Genotypic detection is a budding substitute to recognize phenotypic culture based processes in bacterial identification. AIMS We report a comparative evaluation of biochemical and genomic-based assays for exploring the commonest bacterial flora of infected diabetic foot ulcers along with clinical variables of subjects enrolled. METHODS The pathogens selected (i) Staphylococcus aureus ii) Pseudomonas aeruginosa, iii) Escherichia coli and iv) Klebsiella pneumonia, stood for the most frequent isolates of diabetic foot infection in previous studies from Northern India. Identification of these pathogens were done by conventional assays and polymerase chain reaction. RESULTS Of 50 specimens obtained from infected DFUs, 74% of cases were affirmative by bacteriological assays and 90% showed positivity via polymerase chain reaction (PCR). Among processed samples 44 isolates were detectable through phenotypic analysis and 65 bacteria by species-specific PCR. Thirteen samples and 21 isolates could not be scrutinized by phenotypic identification systems. The most prevalent pathogens identifiable were Klebsiella pneumonia, followed by Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. CONCLUSIONS We have shown that PCR-based diagnostic methods improved the identification compared to conventional methods and highlight the incorporation of PCR due to shorten turnaround time translating into improved clinical outcomes.

Inflammatory markers as risk factors for infection with multidrug-resistant microbes in diabetic foot subjects

BACKGROUND Diabetic foot ulcers (DFUs), a dreadful microvascular complication of diabetes is responsible for substantial increase in morbidity and mortality. Infection, not a cause, but a consequence in DFUs that accounts for minor or major limb loss. The current study aimed to evaluate the microbial etiology of infected diabetic foot ulcers in northern tertiary care hospital, assessment of risk factors and role of inflammatory markers involved in colonization of multidrug-resistant organisms (MDROs) and their impact on the outcome. METHODS Pus aspirates and soft tissue samples from 65 patients with infected DFUs were collected and processed for aerobic culture analysis. Serum concentrations of IL-6 and TNF-α were determined by enzyme linked immuno-sorbent assay. RESULTS Aerobic gram-negative isolates were more commonly present (74.7%), followed by gram-positive aerobes (25.2%). Fifty-seven percent patients were positive for MDROs. IL-6 (pg/mL) was significantly lower in diabetic patients with MDROs infected foot ulcers than without (47.0±17.2 vs. 78.3±22.1 vs. p=<0.001) and TNF-α (pg/mL) was also significantly diminished in MDROs infected subjects than without (144.2±25.8 vs. 168.7±20.9, p<0.001) respectively. CONCLUSIONS In this study diabetic foot wounds harbored by MDROs were associated with longer duration of ulcer and increased ulcer size. Poor glycemic control was also a confounding factor in mounting MDROs infected ulcers. The declined levels WBCs and neutrophils as well as of cytokines IL-6 and TNF-alpha explains compromised immune responses of host in multi drug resistant infections.