Irina M. Russu

Influence of magnesium ions on spontaneous opening of DNA base pairs.

A large amount of experimental evidence is available for the effects of magnesium ions on the structure and the stability of the DNA double helix. Less is known, however, on how these ions affect the dynamics of the molecule and the stability of each individual base pair. The present work addresses these questions by a study of the DNA duplex [dCGCAGATCTGCG]2, and its interactions with magnesium ions using nuclear magnetic resonance (NMR) spectroscopy and proton exchange. Two-dimensional NMR experiments indicate that binding of magnesium to this DNA duplex does not affect its structure. However, even in the absence of structural changes, magnesium ions specifically affect the exchange properties of imino protons in the four GC/CG base pairs that are located in the interior of the double helix. These specific changes do not result from alterations in the rates of spontaneous opening of these base pairs. Instead, the changes most likely reflect an enhancement in the energetic propensity for spontaneous opening of the GC/CG base pairs that is induced by the binding of magnesium ions.

ROTATIONAL DYNAMICS OF ADENINE AMINO GROUPS IN A DNA DOUBLE HELIX

Exocyclic amino groups of the bases undergo conformational fluctuations that affect the recognition and reactivity of nucleic acid molecules. Among these fluctuations, rotation of amino groups around C-N bonds is of special interest. In the present paper, we report the first determination of the rates and energetic parameters for rotation of the N6-amino group of adenine in a DNA double helix. The DNA molecule studied is the dodecamer [d(CGCGAGCTCGCG)]2. The adenine in each A. T basepair of the dodecamer was labeled with 15N at the N6 position, and the NMR resonances of the two protons in the adenine amino group were selectively observed by 15N-editing methods. The rates of rotation of the amino group were obtained from experiments of transfer of magnetization between the two protons in the same group and from lineshape analysis of 15N-edited amino proton NMR resonances. The results show that, over the temperature range from 0 to 70 degrees C, the rates of rotation of adenine amino groups range from 60 to 24,000 s-1. Formation of the activated state during rotation has a standard enthalpy change of 15.3 +/- 0.2 kcal/mol and a standard entropy change of 6.0 +/- 0.7 cal/(mol. K). Analysis of the results suggests that rotation of the amino group occurs in the paired, closed state of the adenine in the A. T basepair of the double-helical DNA structure.

Assembly of Human Hemoglobin STUDIES WITH ESCHERICHIA COLI-EXPRESSED α-GLOBIN

The α-globin of human hemoglobin was expressed in Escherichia coli and was refolded with heme in the presence and in the absence of native β-chains. The functional and structural properties of the expressed α-chains were assessed in the isolated state and after assembly into a functional hemoglobin tetramer. The recombinant and native hemoglobins were essentially identical on the basis of sensitivity to effectors (Cl− and 2,3-diphosphoglycerate), Bohr effect, CO binding kinetics, dimer-tetramer association constants, circular dichroism spectra of the heme region, and nuclear magnetic resonance of the residues in the α1β1 and α1β2 interfaces. However, the nuclear magnetic resonance revealed subtle differences in the heme region of the expressed α-chain, and the recombinant human normal adult hemoglobin (HbA) exhibited a slightly decreased cooperativity relative to native HbA. These results indicate that subtle conformational changes in the heme pocket can alter hemoglobin cooperativity in the absence of modifications of quaternary interface contacts or protein dynamics. In addition to incorporation into a HbA tetramer, the α-globin refolds and incorporates heme in the absence of the partner β-chain. Although the CO binding kinetics of recombinant α-chains were the same as that of native α-chains, the ellipticity of the Soret circular dichroism spectrum was decreased and CO binding kinetics revealed an additional faster component. These results show that recombinant α-chain assumes alternating conformations in the absence of β-chain and indicate that the isolated α-chain exhibits a higher degree of conformational flexibility than the α-chain incorporated into the hemoglobin tetramer. These findings demonstrate the utility of the expressed α-globin as a tool for elucidating the role of this chain in hemoglobin structure-function relationships.

Allosteric free energy changes at the α1β2 interface of human hemoglobin probed by proton exchange of Trpβ37

The energetic changes that occur on ligand binding in human hemoglobin have been investigated by measurements of the exchange rates of the indole proton of Trpβ37(C3). The Trpβ37 residues are located in helices C of the β‐subunits and are involved in contacts with the segments FG of the α‐subunits at the interdimeric α1β2 and α2β1 interfaces of the hemoglobin tetramer. In the quaternary structure change that accompanies ligand binding to hemoglobin, these contacts undergo minimal changes in relative orientation and in packing, thereby acting as hinges, or flexible joints. The exchange rates of the indole proton of Trpβ37(C3) were measured by nuclear magnetic resonance spectroscopy, in both deoxygenated and ligated hemoglobin. The results indicate that, at 15°C, the exchange rate is increased from 9.0 · 10−6 to 3.3 · 10−4 s−1 upon ligand binding to hemoglobin. This change suggests that the structural units at the hinge regions of the α1β2/α2β1 interfaces containing Trpβ37(C3) are specifically stabilized in unligated hemoglobin, and experience a change in structural free energy of ∼4 kcal/(mol tetramer) upon ligand binding. Therefore, the hinge regions of the α1β2/α2β1 interfaces could play a role in the transmission of free energy through the hemoglobin molecule during its allosteric transition. Proteins 2001;44:73–78.

Opening dynamics of 8-oxoguanine in DNA.

8‐oxoguanine is a major lesion of genomic DNA that results from oxidation of guanine by reactive oxygen species. The repair of this lesion is initiated by 8‐oxoguanine glycosylases, which excise the damaged base by “flipping” it outside the DNA double helix. The molecular mechanisms involved in the specific recognition of the damaged base by the enzyme are not yet fully understood. Several models have proposed that, in DNA, the base pair between 8‐oxoguanine and cytosine may possess altered dynamic properties that could help the enzyme locate the lesion and could favor the selective extra‐helical flipping of the damaged base. To test this proposal, we have characterized the spontaneous opening of the base pair between 8‐oxoguanine and cytosine in a DNA double helix using NMR spectroscopy and proton exchange. The results show that the rate of spontaneous opening of 8‐oxoguanine and the lifetime of the base in the extra‐helical state are the same as those of a canonical guanine‐cytosine base pair, in the same base sequence context. This finding suggests that the opening dynamics of 8‐oxoguanine, when paired with cytosine in DNA, does not play a significant role in the recognition of the lesion by glycosylases. Copyright

Internal Dynamics in a DNA Triple Helix Probed by 1H-15N-NMR Spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.

Studying DNA-protein interactions using NMR.

NMR spectroscopy is emerging as a powerful tool in molecular biology and biotechnology; one aspect of which is the use of one- and two-dimensional NMR methodologies to investigate the interactions of proteins with DNA. The dynamic and structural information which NMR can provide, on the changes in conformation and molecular flexibility, complements X-ray crystallography data and enables mechanistic models of DNA-protein interactions to be formulated.

Allosteric effects of chloride ions at the intradimeric α1β1 and α2β2 interfaces of human hemoglobin

The structural transition induced by ligand binding in human hemoglobin encompasses quaternary structure changes at the interfaces between the two αβ dimers. In contrast, the interfaces between α and β subunits within the same dimer (i.e., α1β1 and α2β2 interfaces) are structurally invariant. Previous work from this laboratory using NMR spectroscopy has identified four sites at the intradimeric α1β1 and α2β2 interfaces that, although structurally invariant, experience significant changes in the rates of proton exchange upon ligand binding. These sites are Hisα103(G10) and Hisα122(H5) in each α subunit of the hemoglobin tetramer. In the present work, we show that the proton exchange at the Hisα103(G10) sites is affected by the interactions of hemoglobin with chloride ions. Increasing concentrations of chloride ions at pH 6.45 and at 37°C enhance the exchange rate of the Hisα103(G10) Nε2 proton. The enhancement is greater in deoxygenated than in ligated hemoglobin. In the framework of the local unfolding model for proton exchange, these results suggest that the structural free energy and/or the proton transfer reactions at the Hisα103(G10) sites depend on the concentration of chloride ions. Therefore, the ligand‐induced changes at the Hisα103(G10) sites are modulated by the allosteric effect of chloride ions on hemoglobin. Proteins 2002;49:413–419.

Heteronuclear 15N and 1H Magnetic Resonance Study of a DNA Dodecamer Containing an A3T3 Tract

Two related DNA dodecamers, [d(CGCAAATTTGCG)]2 and [d(CGCGAGCTCGCG)]2, with all adenine residues 15N‐labeled at the amino groups were synthesized. The dynamics and conformational transitions in both dodecamers were investigated using 15N and 1H NMR spectroscopy. It was found that, in the premelting temperature range, the 15N resonances of the first and second adenines in the A3T3 tract of [d(CGCAAATTTGCG)]2 shift downfield with increase in temperature. The change in the 15N chemical shift of the central adenine in the A3T3 tract was an order of magnitude smaller and was similar to that of the single adenine in [d(CGCGAGCTCGCG)]2. These premelting 15N chemical shift changes parallel the pattern of three‐centered hydrogen bonds that could form in the [d(CGCAAATTTGCG)]2 dodecamer. The dynamics of adenine amino groups in both dodecamers were also characterized using 15N T1 and 1H–15N NOE measurements. The data are consistent with the presence of internal motions for adenine amino groups. The motions are highly restricted, with an order parameter S2 of 0.8, and occur on the picosecond time‐scale. The internal motions of the three adenine amino groups in [d(CGCAAATTTGCG)]2 are similar and parallel that of the amino group in the single adenine in [d(CGCGAGCTCGCG)]2.

Specific interactions of divalent metal ions with a DNA duplex containing the d(CA)n/(GT)n tandem repeat.

Abstract Divalent metal ions are essential for maintaining functional states of the DNA molecule. Their participation in DNA structure is modulated by the base sequence and varies depending on the nature of the ion. The present investigation addresses the interaction of Ca2+ ions with a tandem repeat of two CA dinucleotides, (CA)2/(TG)2. The binding of Ca2+ to the repeat is monitored by nuclear magnetic resonance (NMR) spectroscopy using chemical shift mapping. Parallel experiments monitor binding of Mg2+ ions to the repeat as well as binding of each ion to a DNA duplex in which the (CA)2/(TG)2 repeat is eliminated. The results reveal that the direction and the magnitude of chemical shift changes induced by Ca2+ ions in the NMR spectra of the repeat are different from those induced by Mg2+ ions. The differences between the two cations are significantly diminished by the elimination of the (CA)2/(TG)2 repeat. These findings suggest a specific interaction of Ca2+ ions with the (CA)2/(TG)2 motif. The specificity of the interaction resides in the two A-T base pairs of the repeat, and it involves the major groove of the first A-T base pair and both grooves of the second A-T base pair.