Jacqueline R. Wyatt

Conformation of an RNA pseudoknot

Abstract The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3′-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

The Microbial Rosetta Stone Database: A compilation of global and emerging infectious microorganisms and bioterrorist threat agents

BackgroundThousands of different microorganisms affect the health, safety, and economic stability of populations. Many different medical and governmental organizations have created lists of the pathogenic microorganisms relevant to their missions; however, the nomenclature for biological agents on these lists and pathogens described in the literature is inexact. This ambiguity can be a significant block to effective communication among the diverse communities that must deal with epidemics or bioterrorist attacks.ResultsWe have developed a database known as the Microbial Rosetta Stone. The database relates microorganism names, taxonomic classifications, diseases, specific detection and treatment protocols, and relevant literature. The database structure facilitates linkage to public genomic databases. This paper focuses on the information in the database for pathogens that impact global public health, emerging infectious organisms, and bioterrorist threat agents.ConclusionThe Microbial Rosetta Stone is available at http://www.microbialrosettastone.com/. The database provides public access to up-to-date taxonomic classifications of organisms that cause human diseases, improves the consistency of nomenclature in disease reporting, and provides useful links between different public genomic and public health databases.

[14] Biochemical and NMR studies of RNA conformation with an emphasis on RNA pseudoknots

Publisher Summary This chapter discusses the biochemical and nuclear magnetic resonance (NMR) studies of RNA conformation with an emphasis on RNA pseudoknots. Advances in NMR techniques have opened almost innumerable possibilities for the structural studies of RNA. Unfortunately, the size limitation of NMR (ca. 20 kDa, approximately 65 nucleotides) requires a reductionist approach to study the most biologically interesting RNAs and their interaction with ligands. The challenge is to develop a system for NMR study that recapitulates the essential features of the RNA of interest. Since little is known about the detailed conformations of RNA, model systems that concentrate on RNA folding motifs, such as hairpin loops, internal loops, base triples, and pseudoknots, should also be studied. The goal of NMR studies, on either biological RNAs or model systems, is usually the definition of the three-dimensional (3D) structure, using NMR-derived constraints. The chapter concentrates on two general aspects of NMR studies of RNA conformation that are applicable to any system of interest. Phylogenetic and biochemical analyses often highlight the sequence elements that are important for function and that are, therefore, of structural interest.

18 RNA Structural Elements and RNA Function

The structural elements that now exist in RNA must have evolved to provide chemical stability and to facilitate their biological functions. Structural biologists believe that determining the conformation and stability of the structures adopted by RNA will provide a better understanding of their functions. This belief is based mainly on the success of Watson and Crick with double strands for DNA. Even this archetype only shows that complementary base-pairing makes replication easy; the details of helix twist and of A-form, B-form, … or Z-form geometry are less useful. Nevertheless, we continue to be optimistic and to study RNA structure in the hope that it will provide hints about how RNA does its many jobs. The main value of a structure is to suggest new experiments. The structure allows predictions about the effect of mutations, inhibitors, and enhancers, and about the mechanisms of the reactions. The overall goal is to learn the general features of RNA structure that can be inferred from the sequence and then to relate these structures to biological functions. It is important to recognize that a molecule is not a rigid object; structural elements are dynamic. Single-stranded loops are mobile, base pairs can form and break, and even base-paired helical regions can bend and flex. The presence or absence of structure depends not only on the sequence, but also on the temperature and the environment in general. This means that knowledge of the thermodynamics of structure formation is crucial (for review, see Turner and Bevilacqua, this volume).