Jacques Paoletti

NCp7 Activates HIV-1Lai RNA Dimerization by Converting a Transient Loop-Loop Complex into a Stable Dimer

Nucleocapsid protein 7 (NCp7), the human immunodeficiency virus type 1 (HIV-1) nucleocapsid protein, was shown to strongly potentiate the dimerization of the retroviral genomic RNA. This process involves the interaction of two retroviral RNA monomer subunits near their 5′-ends. A region located upstream from the splice donor site was recently identified as being responsible for the formation of dimeric HIV-1 RNA. This region appeared to be confined within a stem-loop structure, with an autocomplementary sequence in the loop. In an in vitro study of spontaneous dimer formation, we reported that the 77-402 RNA transcript forms two distinct dimers differing in their thermostability: D37 and D55. We identified D37 as a “kissing” complex structure, formed via a loop-loop interaction between the two monomers, and D55 as a double stranded structure involving all nucleotides of the stem-loop via canonical base pairing. In this report, we have characterized the role of NCp7 in the HIV-1Lai RNA dimerization process by using in vitro dimerization assays with RNA transcripts of different lengths and dimer thermal dissociation. Our results show that the nucleocapsid protein NCp7 activates RNA dimerization very likely through interaction with the kissing complex and converts it into a stable dimer. Furthermore, this NCp7-promoted conversion only occurs if the 240-280 stem-loop structure is present in HIV-1Lai RNA molecules and contains the autocomplementary G257CGCGC262 sequence. This study suggests that, under physiological conditions, an NCp7-mediated RNA conformational change is involved in the maturation of the HIV-1 RNA dimer.

A new NMR solution structure of the SL1 HIV-1Lai loop-loop dimer

Dimerization of genomic RNA is directly related with the event of encapsidation and maturation of the virion. The initiating sequence of the dimerization is a short autocomplementary region in the hairpin loop SL1. We describe here a new solution structure of the RNA dimerization initiation site (DIS) of HIV-1Lai. NMR pulsed field-gradient spin-echo techniques and multidimensional heteronuclear NMR spectroscopy indicate that this structure is formed by two hairpins linked by six Watson–Crick GC base pairs. Hinges between the stems and the loops are stabilized by intra and intermolecular interactions involving the A8, A9 and A16 adenines. The coaxial alignment of the three A-type helices present in the structure is supported by previous crystallography analysis but the A8 and A9 adenines are found in a bulged in position. These data suggest the existence of an equilibrium between bulged in and bulged out conformations in solution.

Corrections for instrumental errors in measurement of fluorescence and polarization of fluorescence

Abstract Calculations have been made to allow corrections for instrumental errors in the measurement of fluorescence and polarization coefficient. These errors are due to differences in transmittivities of the instruments for the horizontal and vertical components of the light. The relative error made in the quantum efficiency determination can be as large as 12%. When natural light is used for polarization measurement the relative error can be 15%. Special attention has been given to the case in which polarization measurements are used for measurements of binding of small molecules to macromolecules.

The change of the torsion of the DNA helix caused by intercalation: I — A discussion of the two different possibilities, winding or unwinding

Summary The four basic assumptions made by Lerman to establish his intercalation model are discussed. It is explained how according to this model intercalation can only lead to an unwinding of the DNA helix. On the other hand, it is shown that by changing one of the four basic assumptions made by Lerman , one can build an intercalation model leading possibly to a limited winding of the DNA helix and to the exclusion of one site per each intercalated site.

Interaction of cis-diamminedichloroplatinum (II) to chromatin: Specificity of the drug distribution

We have studied the interaction of the antitumoral drug, cis-diamminedichloroplatinum (II), cis-DDP, to chromatin. Degradation of chromatin-platinum complexes with micrococcal nuclease releases the platinum bound to the linker DNA. By comparing the percentage of platinum released throughout the digestion to the percentage of acid-soluble DNA we suggest that the linker DNA is the preferential target for this drug. This is mainly the case when the amount of bound platinum is low (r less than 0.03) and is less at higher drug concentrations. By comparing the rate constants corresponding to the reaction of cis-DDP to chromatin, DNA or core particle it appears that these constants are the same. This indicates that the bound platinum is located mainly at the DNA level. Our results are discussed with respect to the structure of chromatin and we conclude that this structure should play a role in the in vivo association of cis-DDP to DNA.

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex

Abstract The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV-1Lai RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 °C) was found slightly higher than the one of the corresponding RNA dimer (32 °C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100° with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5Å. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20° between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

Relaxation of chromatin structure induced by ethidium binding: 1--Micrococcal nuclease digestion of the ethidium--chromatin complex.

Abstract Degradation of chromatin by micrococcal nuclease is activated in the presence of ethidium bromide. This activation is shown by an increase in the rate of appearance of acid soluble material and by a more rapid conversion of chromatin toward mononucleosomes. Relaxation of chromatin structure is suggested as the mechanism responsible for this activation.

Subunit organization of Euglena chromatin

Abstract Digestion of Euglena nuclei or extracted chromatin with micrococcal nuclease results in the identification of a repeating structure. The DNA repeat size, analyzed on agarose and polyacrylamide gels, is found to be 225±13 base pairs. DNase I digestion produces a serie of fragments multiples of roughly 10 bases. Eventhough pressure shearing is necessary to disrupt the though pellicule of the phytoflagellate, we confirm that, in Euglena , chromatin organization is similar to that of other eukaryotes.

Interaction of cis-diamminedichloroplatinum (II) with sensitive and resistant L1210 cell lines: Drug binding to nuclei and DNA

We used in parallel, to study the kinetics of cis-DDP cellular binding and distribution, a cL cell culture line established from L1210 murine leukemia ascites and its cLP derivative which acquired a 30-fold (ID50) resistance to cis-diamminedichloroplatinum(II). Cell cultures were incubated with 0.9 microgram/ml (3 microM) of the drug and after various incubation times up to 24 hr, the amount of platinum associated to whole cells, to isolated nuclei and to purified DNA was determined using atomic absorption spectrophotometry. For the first hours of incubation no significant difference in the rate of platinum association was observed between the two cell lines. After the first hours of incubation the amount of platinum associated to whole cells and to isolated nuclei was significantly higher in the drug sensitive cells. However, the rates of platinum association to the respective DNAs were quite similar in the two cell lines. Our study failed to demonstrate any significant quantitative modification of the overall drug-DNA association between the resistant and sensitive cell lines.

Structural features associated with α- anomerie in oligo-α-thymidylates

Abstract Comparison between gel electrophoresis migrations of oligo-α-thymidylates and oligo-β-thymidylates indicates that the migration of α-oligonucleotides under native conditions is different from the migration of β-oligonucleotides when the number of thymines, part of the sequence, is higher than 5. Such difference disappears when the gels are run under denaturing conditions. This, together with UV spectra, indicates that the structure of α-oligonucleotides is more organized than the structure of β-oligonucleotides and that such an organisation appears for a length higher than 5 monomeric units.