James B. Koprich

Dynamic Changes in Presynaptic and Axonal Transport Proteins Combined with Striatal Neuroinflammation Precede Dopaminergic Neuronal Loss in a Rat Model of AAV α-Synucleinopathy

Little is known about key pathological events preceding overt neuronal degeneration in Parkinsons disease (PD) and α-synucleinopathy. Recombinant adeno-associated virus 2-mediated delivery of mutant (A53T) human α-synuclein into the substantia nigra (SN) under a neuron-specific synapsin promoter resulted in protracted neurodegeneration with significant dopaminergic (DA) neuron loss by 17 weeks. As early as 4 weeks, there was an increase in a dopamine metabolite, DOPAC and histologically, DA axons in the striatum were dystrophic with degenerative bulbs. Before neuronal loss, significant changes were identified in levels of proteins relevant to synaptic transmission and axonal transport in the striatum and the SN. For example, striatal levels of rabphilin 3A and syntaxin were reduced. Levels of anterograde transport motor proteins (KIF1A, KIF1B, KIF2A, and KIF3A) were decreased in the striatum, whereas retrograde motor proteins (dynein, dynamitin, and dynactin1) were increased. In contrast to reduced levels in the striatum, KIF1A and KIF2A levels were elevated in the SN. There were dramatic changes in cytoskeletal protein levels, with actin levels increased and α-/γ-tubulin levels reduced. In addition to these alterations, a neuroinflammatory response was observed at 8 weeks in the striatum, but not in the SN, demonstrated by increased levels of Iba-1, activated microglia and increased levels of proinflammatory cytokines, including IL-1β, IFN-γ and TNF-α. These results demonstrate that changes in proteins relevant to synaptic transmission and axonal transport coupled with neuroinflammation, precede α-synuclein-mediated neuronal death. These findings can provide ideas for antecedent biomarkers and presymptomatic interventions in PD.

The Toll-Like Receptor-3 Agonist Polyinosinic:Polycytidylic Acid Triggers Nigrostriatal Dopaminergic Degeneration

In Parkinsons disease (PD), loss of striatal dopaminergic (DA) terminals and degeneration of DA neurons in the substantia nigra (SN) are associated with glial reactions. Such inflammatory processes are commonly considered an epiphenomenon of neuronal degeneration. However, there is increasing recognition of the role of neuroinflammation as an initiation factor of DA neuron degeneration. To investigate this issue, we established a new model of brain inflammation by injecting the Toll-like receptor 3 (TLR-3) agonist polyinosinic:polycytidylic acid [poly(I:C)] in the SN of adult rats. Poly(I:C) injection induced a sustained inflammatory reaction in the SN and in the dorsolateral striatum. Significant changes were detected in proteins relevant to synaptic transmission and axonal transport. In addition, cytoplasmic mislocalization of neuronal TAR DNA binding protein TDP-43 was observed. Poly(I:C) injection increased the susceptibility of midbrain DA neurons to a subsequent neurotoxic trigger (low-dose 6-hydroxydopamine). Systemic delivery of interleukin-1 receptor antagonist protected SN DA neurons exposed to combined poly(I:C) induced inflammatory and neurotoxic oxidative stress. These data indicate that viral-like neuroinflammation induces predegenerative changes in the DA system, which lowers the set point toward neuronal dysfunction and degeneration. New powerful neuroprotective therapies for PD might be considered by targeting critical inflammatory mechanisms, including cytokine-induced neurotoxicity.

Prenatal 3,4-methylenedioxymethamphetamine (ecstasy) alters exploratory behavior, reduces monoamine metabolism, and increases forebrain tyrosine hydroxylase fiber density of juvenile rats

3,4-Methylenedioxymethamphetamine (MDMA; ecstasy) use has risen among women of childbearing age. Consequently, there is a substantial risk for fetal exposure from women who are, or become pregnant while abusing MDMA. However, attempts to demonstrate that prenatal MDMA results in neurochemical alterations in rat models have failed. MDMA administration to neonatal rats (third trimester equivalent) results in significant and persistent neurochemical and behavioral alterations, yet human epidemiologic data suggest that the vast majority of prenatal exposure is limited to the first trimester. The following study was conducted to reexamine the potential for prenatal MDMA administration to produce lasting postnatal neurochemical and behavioral alterations using a new rodent model. Pregnant rats were administered twice-daily injections of MDMA (15 mg/kg sc) or saline from embryonic days (E) 14-20. Prenatally exposed pups were examined on postnatal days (P) 3 and 21. At P3, MDMA offspring showed reductions in the dopamine metabolite homovanillic acid which persisted through P21, along with reductions in the serotonin (5-HT) metabolite, 5-HIAA. Prenatally exposed MDMA animals at P21 also had reduced dopamine and 5-HT turnover in the nucleus accumbens. Increases in tyrosine hydroxylase fiber density were found in the frontal cortex, striatum and nucleus accumbens of MDMA animals. In addition, prenatal MDMA significantly increased locomotor activity of P21 pups in a 20-min novel cage environment. These findings provide the first evidence of lasting neurochemical and behavioral alterations following prenatal MDMA. Further investigation is warranted to elucidate possible mechanisms of action and to monitor children gestationally exposed to MDMA.

Nigrostriatal Dysfunction in Familial Alzheimer's Disease-Linked APPswe/PS1ΔE9 Transgenic Mice

Alzheimers disease (AD) is often accompanied by extrapyramidal signs attributed to nigrostriatal dysfunction. The association between amyloid deposition and nigrostriatal degeneration is essentially unknown. We showed previously that the striatum and the substantia nigra of transgenic mice harboring familial AD (FAD)-linked APPswe/PS1ΔE9 mutants exhibit morphological alterations accompanied by amyloid-β (Aβ) deposition (Perez et al., 2004). In the present study, we further investigated the interaction between Aβ deposition and dopaminergic nigrostriatal dysfunction, by correlating morphological and biochemical changes in the nigrostriatal pathway with amyloid deposition pathology in the brains of 3- to 17-month-old APPswe/PS1ΔE9 transgenic mice and age-matched wild-type controls. We show that Aβ deposition is pronounced in the striatum of APPswe/PS1ΔE9 mice at 6 months of age, and the extent of deposition increases in an age-dependent manner. Tyrosine hydroxylase (TH)-positive dystrophic neurites with rosette or grape-like cluster disposition are observed adjacent to Aβ plaques and display multilaminar, multivesicular, and dense-core bodies as well as mitochondria. In addition, an age-dependent increase of TH protein levels are shown in nigral cells in these mutant mice. Using HPLC analysis, we found a reduction in the dopamine metabolite DOPAC in the striatum of these mice. These findings show a close association between amyloid deposition and nigrostriatal pathology and suggest that altered FAD-linked amyloid metabolism impairs, at least in part, the function of dopaminergic neurons.

Neonatal 3,4-methylenedioxymethamphetamine (ecstasy) alters dopamine and serotonin neurochemistry and increases brain-derived neurotrophic factor in the forebrain and brainstem of the rat

Growing concerns surround the risk of fetal exposure to 3,4-methylenedioxymethamphetamine (MDMA; ecstasy). Prior animal studies using neonatal rats administered MDMA from postnatal days (P) 11-20 (a period approximating third trimester brain development in humans) have demonstrated long-lasting decrements in serotonin (5-HT) and learning; however, no studies have examined the acute post-MDMA response of the brain at this early age. Specifically, it is of interest whether MDMA administration to neonatal rats produces the expected depletion of monoamines and whether the brain exhibits any ameliorative response to the pharmacologic insult. In the current study, this model was employed to determine whether forebrain and brainstem dopamine (DA) and 5-HT neurochemistry were altered 24 h after the last injection (P21), and whether brain-derived neurotrophic factor (BDNF) was upregulated in response to MDMA exposure. All forebrain structures examined (frontal cortex, hippocampus, and striatum) showed significant MDMA-induced reductions in 5-HT and its metabolite, 5-HIAA, and significant increases in the DA metabolite, HVA, as well as DA turnover (HVA/DA). In the brainstem, there were significant increases in 5-HIAA, HVA and DA turnover. BDNF was significantly increased (19-38%) in all forebrain structures and in the brainstem in MDMA-exposed neonates versus saline controls. These data suggest that MDMA exposure to the developing rat brain from P11-20 produces similar alterations in serotonin and dopamine neurochemistry to those observed from adult administrations. In addition, a compensatory increase in BDNF was observed and may be the brains ameliorative response to minimize MDMA effects. This is the first report demonstrating that MDMA exposure results in increased levels of BDNF and that such increases are correlated with changes in monoamine levels. Future research is needed to elucidate any deleterious effects MDMA-induced increases in trophic activity might have on the developing brain and to examine earlier gestational exposure periods in order to assess the risk throughout pregnancy.

An Endogenous Serine/Threonine Protein Phosphatase Inhibitor, G-Substrate, Reduces Vulnerability in Models of Parkinson's Disease

Relative neuronal vulnerability is a universal yet poorly understood feature of neurodegenerative diseases. In Parkinsons disease, dopaminergic (DA) neurons in the substantia nigra (SN) (A9) are particularly vulnerable, whereas adjacent DA neurons within the ventral tegmental area (A10) are essentially spared. Our previous laser capture microdissection and microarray study (Chung et al., 2005) demonstrated that molecular differences between these DA neurons may underlie their differential vulnerability. Here we show that G-substrate, an endogenous inhibitor of Ser/Thr protein phosphatases, exhibits higher expression in A10 compared with A9 DA neurons in both rodent and human midbrain. Overexpression of G-substrate protected dopaminergic BE(2)-M17 cells against toxins, including 6-OHDA and MG-132 (carbobenzoxy-l-leucyl- l-leucyl-l-leucinal), whereas RNA interference (RNAi)-mediated knockdown of endogenous G-substrate increased their vulnerability to these toxins. G-substrate reduced 6-OHDA-mediated protein phosphatase 2A (PP2A) activation in vitro and increased phosphorylated levels of PP2A targets including Akt, glycogen synthase kinase 3β, and extracellular signal-regulated kinase 2 but not p38. RNAi to Akt diminished the protective effect of G-substrate against 6-OHDA. In vivo, lentiviral delivery of G-substrate to the rat SN increased baseline levels of phosphorylated Akt and protected A9 DA neurons from 6-OHDA-induced toxicity. These results suggest that inherent differences in the levels of G-substrate contribute to the differential vulnerability of DA neurons and that enhancing G-substrate levels may be a neuroprotective strategy for the vulnerable A9 (SN) DA neurons in Parkinsons disease.

Functional enhancement and protection of dopaminergic terminals by RAB3B overexpression

In Parkinsons disease (PD), dopaminergic (DA) neurons in the substantia nigra (SN, A9) are particularly vulnerable, compared to adjacent DA neurons within the ventral tegmental area (VTA, A10). Here, we show that in rat and human, one RAB3 isoform, RAB3B, has higher expression levels in A10 compared to A9 neurons. RAB3 is a monomeric GTPase protein that is highly enriched in synaptic vesicles and is involved in synaptic vesicle trafficking and synaptic transmission, disturbances of which have been implicated in several neurodegenerative diseases, including PD. These findings prompted us to further investigate the biology and neuroprotective capacity of RAB3B both in vitro and in vivo. RAB3B overexpression in human dopaminergic BE (2)-M17 cells increased neurotransmitter content, [3H] dopamine uptake, and levels of presynaptic proteins. AAV-mediated RAB3B overexpression in A9 DA neurons of the rat SN increased striatal dopamine content, number and size of synaptic vesicles, and levels of the presynaptic proteins, confirming in vitro findings. Measurement of extracellular DOPAC, a dopamine metabolite, following l-DOPA injection supported a role for RAB3B in enhancing the dopamine storage capacity of synaptic terminals. RAB3B overexpression in BE (2)-M17 cells was protective against toxins that simulate aspects of PD in vitro, including an oxidative stressor 6-hydroxydopamine (6-OHDA) and a proteasome inhibitor MG-132. Furthermore, RAB3B overexpression in rat SN both protected A9 DA neurons and resulted in behavioral improvement in a 6-OHDA retrograde lesion model of PD. These results suggest that RAB3B improves dopamine handling and storage capacity at presynaptic terminals, and confers protection to vulnerable DA neurons.

Ectopic galanin expression and normal galanin receptor 2 and galanin receptor 3 mRNA levels in the forebrain of galanin transgenic mice.

The functional interactions of the neuropeptide galanin (GAL) occur through its binding to three G protein-coupled receptor subtypes: galanin receptor (GALR) 1, GALR2 and GALR3. Previously, we demonstrated that GALR1 mRNA expression was increased in the CA1 region of the hippocampus and discrete hypothalamic nuclei in galanin transgenic (GAL-tg) mice. This observation suggested a compensatory adjustment in cognate receptors in the face of chronic GAL exposure. To evaluate the molecular alterations to GALR2 and GALR3 in the forebrain of GAL overexpressing mice, we performed complementary quantitative, real-time PCR (qPCR), in situ hybridization, and immunohistochemistry in select forebrain regions of GAL-tg mice to characterize the neuronal distribution and magnitude of GAL mRNA and peptide expression and the consequences of genetically manipulating the neuropeptide GAL on the expression of GALR2 and GALR3 receptors. We found that GAL-tg mice displayed dramatic increases in GAL mRNA and peptide in the frontal cortex, posterior cortex, hippocampus, septal diagonal band complex, amygdala, piriform cortex, and olfactory bulb. Moreover, there was evidence for ectopic neuronal GAL expression in forebrain limbic regions that mediate cognitive and affective behaviors, including the piriform and entorhinal cortex and amygdala. Interestingly, regional qPCR analysis failed to reveal any changes in GALR2 or GALR3 expression in the GAL-tg mice, suggesting that, contrary to GALR1, these receptor genes are not under ligand-mediated regulatory control. The GAL-tg mouse model may provide a useful tool for the investigation of GAL ligand-receptor relationships and their role in normal cognitive and affective functions as well as in the onset of neurological disease.

Prenatal exposure to MDMA alters noradrenergic neurodevelopment in the rat

3,4-methylenedioxymethamphetamine (MDMA; ecstasy) binds with high affinity to the norepinephrine transporter (NET), making the noradrenergic system a potential target during fetal exposure. Recent data indicate that adult rats that had been prenatally exposed to MDMA display persistent deficits in working memory and attention; behaviors consistent with abnormal noradrenergic signaling in the forebrain. The present study was designed to investigate whether prenatal exposure to MDMA from embryonic days 14-20 affects the structure and/or function of the noradrenergic system of the rat on postnatal day 21. Offspring that were prenatally exposed to MDMA exhibited an increase in noradrenergic fiber density in the prelimbic region of the prefrontal cortex and the CA1 region of the hippocampus that was not accompanied by an increase in the number of noradrenergic neurons in the locus coeruleus. Direct tissue autoradiography using tritiated nisoxetine demonstrated that while NET binding was not altered in the prelimbic cortex, the dentate gyrus, or the locus coeruleus, it was increased in the CA1, CA2, and CA3 regions of the hippocampus. Basal levels of norepinephrine were increased in the prefrontal cortex and the nucleus accumbens of MDMA-exposed rats, as compared to saline-treated controls. These findings indicate that prenatal exposure to MDMA results in structural changes in the noradrenergic system as well as functional alterations in NE neurotransmission in structures that are critical in attentional processing.

Corrigendum to “ectopic galanin expression and normal galanin receptor 2 and galanin receptor 3 mRNA levels in the forebrain of galanin transgenic mice” [Neuroscience 133 (2005) 371–380]

The quantitative PCR (qPCR) primer sequences reported for mouse galanin receptor 2 (GALR2) mRNA [forward primer (5=-3=) TGCTCTTCTGTACCTCTCACGTCTG; reverse primer (5=-3=) AAGTTGGTTTTTATTGG] are specific for the mouse GALR1 receptor, whereas the primer sequences reported for mouse GALR3 mRNA [forward primer (5=-3=) CAGATTGCGAGAGTGGTGACATAG; reverse primer (5=-3=) GGATCTCAGGTAGTTCAAGGACTCC] are specific for mouse GALR2 message. Therefore, the qPCR data describing regional GALR2 expression in GAL wild type (WT) and GAL transgenic (GAL-tg) mouse forebrain actually refer to GALR1 expression, whilst data reported for GALR3 should instead be attributed to GALR2. The revised qPCR component of our report indicates that GALR1 and GALR2 mRNA levels do not change in seven different subregions (e.g., piriform cortex, hippocampus, amygdala) of the GAL-tg mouse forebrain compared to the WT mouse. This contrasts with a previous in situ hybridization study showing increased GALR1 mRNA in hippocampal CA1 neurons of these same GAL-tg mice (Hohmann et al., 2003). These observations suggest that GAL overexpression does not influence global GALR1 or GALR2 expression in the mouse forebrain but that changes in GALR expression in GAL-tg mice may be restricted to discrete neuronal groups. These focal alterations in GALR expression are likely undetectable by regional qPCR analysis.