James John

Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia.

Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were blaTEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae.Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were blaTEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae.

The quorum sensing molecule N-acyl homoserine lactone produced by Acinetobacter baumannii displays antibacterial and anticancer properties

Abstract Secretory N-acyl homoserine lactones (AHLs) mediate quorum sensing (QS) in bacteria. AHLs are shown to be inhibitory for an unrelated group of bacteria and might mimic host signalling elements, thereby subverting the regulatory events in host cells. This study investigated the AHL produced by Acinetobacter baumannii and analysed its effect on other bacterial species and mammalian cells. Chemically characterized AHL had an m/z value of 325 with a molecular formula C18H31NO4 and showed its inhibitory potential against Staphylococcus aureus. Molecular docking studies identified D-alanine-D-alanine synthetase A, a cell wall synthesizing enzyme of S. aureus having a strong binding affinity towards AHL. Electron microscopy showed the disruption and sloughing off of the S. aureus cell wall when treated with AHL. In vitro experiments revealed that this bacteriostatic AHL showed time-dependent activity and induced apoptosis in cancer cell lines. This compound could be a potential structural backbone for constructing new AHL analogues against S. aureus. The findings emphasize the need to re-evaluate all previously characterized AHLs for any additional new biological functions other than QS.

Serological and molecular capsular typing, antibiotic susceptibility of Streptococcus pneumoniae isolates from invasive and non-invasive infections

Streptococcus pneumoniae causes life threatening infections and necessitate for impediment and controlling disease; to conquer this, information is needed about serotype distribution and patterns of antibiotic resistance. The present study was to determine the serotype distribution of S. pneumoniae isolated from the entire age group individual and to correlate this distribution with susceptibility. Cases of pneumococcal infections have been reviewed for serotyping and antibiotic susceptibility. Out of 117 pneumococcal isolates 45 (39%) were penicillin-resistant, 84 (72%) were erythromycin-resistant and 100% were co-trimoxazole resistant. The most frequently isolated serotypes were 23F, 19F, 14, 6B, 5, 6A, 19A and 9V. PCV7, PCV10 and PCV13 coverage was 68%, 79%, 87%, respectively. Similarly, there was similarity in PCV7 coverage for non invasive isolates (64.5%) and invasive isolates (72.2%). The study state that common pneumococcal serotypes were present in similar ways as reported in literature. A continuous survey of pneumococcal infected population is requirement and necessity for success of vaccination.

A 6-year surveillance of antimicrobial resistance patterns of Acinetobacter baumannii bacteremia isolates from a tertiary care hospital in Saudi Arabia during 2005-2010

Multidrug resistance (MDR) of Acinetobacter baumannii increasingly jeopardizes the health care setting leading to substantial mortality and morbidity globally. During the past decade, entirely resistant A. baumannii strains presented a real challenge to clinicians and posed difficulties in therapy. MDR of A. baumannii– associated infections, with adverse clinical outcomes involving the respiratory tract, blood, soft tissues, urinary tract, and central nervous system, significantly increases the outlay of the infirmary. Being Gram-negative coccobacilli and an obligate aerobe, A. baumannii causes both community- and hospital-acquired infection outbreaks in intensive care units especially in countries with tropical climates. Of particular concern, we sought to reveal the status of antimicrobial resistance in A. baumannii bacteremia isolates, the trends and relative frequency of multidrug resistance pattern and also the underlying clinical condition among patients with A. baumannii bacteremia at Riyadh Military hospital, Saudi Arabia, from January 2005 to December 2010. (Published: 3 April 2014) Citation: Libyan J Med 2014, 9 : 24039 - http://dx.doi.org/10.3402/ljm.v9.24039

Historical development of typing methods for Streptococcus pneumoniae

Streptococcus pneumoniae is a major cause of morbidity and mortality in developing countries, especially in children, even though this is a vaccine-preventable disease. Several vaccines are available for which programmes are in regular immunization, but the success of this depends upon their efficacy and vaccine coverage of the serotypes prevalent in the region. A so-called replacement phenomenon has made it mandatory that there should be a regular and continuous survey of serotype prevalence whenever the vaccine is used. Many typing methods have been described including serology as well as molecular-based typing. We have analysed most of the described typing methods for pneumococcal isolates and discussed their prospects for future surveillance programmes. In brief, molecular typing such as sequential multiplex PCR is more reliable for typing, but it has limitations as it types the isolates only up to serogroup level in few cases, and therefore is still dependent on conventional serotyping methods like Quellung and co-agglutination. However, conventional typing methods are limited because of cross-reactivity with other serotypes within serogroups. Conventional serological methods are costly, labour-intensive, and prone to misidentification, whereas current DNA-based methods have limited serotype coverage requiring multiple PCR primers. Implementation of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to consider vaccine effectiveness and subsequent substitution of serotypes.

A reminiscent review on leprosy

Leprosy is caused by Mycobacterium leprae and has been known since biblical times. It was first discovered by the Norwegian physician Gerhard Armauer Hansen in 1873. Despite being the first pathogen to be described, it is yet to be clearly understood owing to the uncultivable nature. Leprosy has been a major public health problem in tropical countries for many decades. Leprosy still persists as a significant burden on public health worldwide. This disease is transmitted by close and prolonged contact through inhalation of the bacilli contained in nasal secretion or through skin erosions. Early diagnosis of subclinical or earner-state leprosy has been problematic. There is a substantial decrease in the prevalence of leprosy, but it still persists in a few regions of the world, India being one of them. However, repost incidence from this region has not been reported in last few years. This review article aims to discuss the aetiology, epidemiology and clinical aspects of leprosy with a retrospective view.

Distribution of different genes responsible for invasive characteristics, detection of point mutations in capsular gene wchA and biofilm production among the invasive and non-invasive isolates of Streptococcus pneumoniae

Background: Streptococcus pneumoniae continues to cause morbidity and mortality across the globe, with developing countries bearing the brunt of the disease. It is mainly responsible for meningitis, pneumonia and septicaemia primarily in children, elderly and immunocompromised persons. Colonisation and persistence in the human nasopharynx occur during early childhood, and it appears to be prerequisite for invasive pneumococcal disease (IPD). Factors that help in persistent colonisation and subsequent invasion are ill understood. Several virulence factors have been incriminated for nasopharyngeal carriage (NC) as well as for the manifestation of the pathogenesis of IPD. Materials and Methods: This study attempts to characterise the S. pneumoniae isolates through analysing the distribution of different virulence markers such as lytA, ply, pbpA, eno, psaA, amiA, ciaR and wchA among the isolates obtained from disease and NC. A total of 37 isolates which include 14 invasive and 23 non-invasive isolates were investigated by polymerase chain reaction to detect the genes. Eight representative isolates were investigated for mutations in wchA by DNA sequencing that may responsible for capsular variation. Results: Ply, pbpA, amiA and eno were observed in a greater percentage of invasive isolates than non-invasive isolates though these differences are not statistically significant. Other two genes ciaH and psaA did not show any significant difference between two groups of isolates. Biofilm production was significantly higher in than non-invasive isolates when compared to invasive isolates. Sequence analysis of wchA revealed three significant point mutations or single-nucleotide polymorphisms (SNPs) among the isolates of one particular cluster (cluster III). These SNPs are responsible for a non-synonymous mutation in wchA bringing in an amino acid change in WchA protein, which is a part of the capsule of S. pneumoniae. Notably, all the three isolates present in cluster III had these SNPs and all of them were isolated from ocular infections. Conclusion: The results of our study implies a possible capsular variations among the isolates and this may have an impact on capsular typing.

Fatal infection in adults by pneumolysin & autolysin producing, non-vaccine serotype Streptococcus pneumonia.

Sir, Despite variable levels of antibiotic resistance in clinical isolates of Streptococcus pneumoniae reported from India, invasive pneumococcal infection continues to pose a challenge in children1. It is a paradox that the susceptibility of pneumococci to antibiotics is not as major a problem as it is observed with staphylococci, enterococci and the Gram-negative bacteria, though outcome of some of the pneumococcal infections are fatal2. Rapidly progressive disease in the vulnerable population namely, the very young and the elderly is a challenge to the treating physician, a factor which is compounded by lack of confirmatory diagnosis due to poor laboratory support. Sporadic reports of adult pneumococcal infections have been documented3. Factors predisposing this group to fatal pneumococcal infection are unknown4. Vaccination of the adult population is limited to the very elderly and those with risk of underlying immunosuppression and splenectomized persons5. We encountered two cases of invasive pneumococcal infections in adult patients with progressive illness with a fatal outcome in a tertiary care centre in south India during 2012. An attempt was made to detect virulence genes coding for pneumolysin (ply) and autolysin (lytA), as these two antigens are known to be associated with virulence of S. pneumoniae in experimental animals6. The first case was a 72 years old male with loss of consciousness for 12 h, brought to the emergency unit of Pondicherry Institute of Medical Sciences, Puducherry, India. He had no history of fever, breathlessness or seizures. He did not have any known risk factors. At admission he had respiratory distress and was transferred to the intensive care unit (ICU) for intubation. Chest X- ray showed bilateral infiltrates with pneumothorax on the left side. Computed tomography (CT) of the brain revealed dilated ventricles. Initial laboratory investigations revealed the following values: total WBC count of 9800/mm3, differential count of 89 per cent neutrophils, 8 per cent lymphocytes and 3 per cent monocytes. A preliminary diagnosis of sepsis with pneumonia and pyogenic meningitis was made. He was started empirically on cefoperazone sulbactam, metronidazole and doxycycline (due to the area being endemic for scrub typhus). Subsequently, blood and CSF cultures grew S. pneumoniae (IBT 1960) (serotyped as 33C- Pneumotest- Statens Serum Institute, Solna, Sweden), which was susceptible to ampicillin, penicillin (by oxacillin screen), ceftriaxone, cefotaxime and vancomycin. Following the culture report antibiotics were changed to vancomycin and ampicillin. He developed hypotension and shock, and despite ventilatory support, administration of intravenous fluids, antibiotics and vassopressor agents his condition deteriorated and he died within 48 h of admission. The second case was a 47 year old male who was conscious but restless and disoriented, and was brought to the casualty of this hospital. There was history of fever and shortness of breath for two weeks, cough for one week and chest pain for two days. There was no other co-morbid condition. Chest X-ray revealed right lower lobe consolidation. Complete blood count revealed total WBC count to be 24000/mm3 and a differential count suggestive of pyogenic infection (95% neutrophils, 4% lymphocytes, 1% monocytes). A diagnosis of right lower lobe pneumonia associated with acute respiratory distress syndrome, sepsis and multi-organ dysfunctional syndrome was made. He was empirically started on linezolid, imipenem and piperacillin-tazobactam. Sepsis was confirmed by a positive blood culture for S. pneumoniae (IBT -1975; serotype 7C), which was sensitive to penicillin, ciprofloxacin, ceftriaxone, erythromycin, gentamicin and vancomycin. The patient was continued with linezolid, imipenem while azithromycin was added. His condition continued to deteriorate and he succumbed to the infection within 72 h of admission. The two isolates were further tested for the presence of different virulence determinants such as genes encoding for pneumolysin (ply), autolysin (lytA) and to document presence of virulence factors and penicillin binding protein (pbpA)7. The primer details are given below: lytA (size 319 bp)4 forward primer F-5’AACCGTACAGAATGAAGCGG-3’ and reverse primer R-5’ TATTCGTGCAATACTCGTGCG-3’; ply (size 348 bp) forward primer F- 5’ATTTCTGTAACAGCTACCAACGA3’ and reverse primer R- 5’GAATTCCCTGTCTTTTCAAAGTC3’; pbpA (size-789 bp) forward primer F-5’CCGTATCCTGGGAGCTTTCTT-3’ and reverse primer R-5’-TCGCGGTTTGTTTCTACTGC-3’. All primers used in the study were designed using GeneTool software and custom synthesize by Eurofins (Bengaluru, India), used in previously described study7. All three genes were detected in both the isolates (Figure). Figure Pneumolysin (ply), autolysin (lytA) and modified penicillin binding protein (pbpA) genes amplified in the two isolates from cases of fatal pneumococcal infection. Amplicon sizes: ply - 348 bp; lytA - 319 bp and pbpA - 789 bp. M - 100 bp ladder (Gene ruler); ... Rapidly fatal pneumococcal disease is known to occur in immunocompromised individuals, splenectomized individuals and HIV infected patients are at increased risk of developing severe pneumococcal disease8,9. Fatal outcome in the immunocompetent patients have been infrequently reported in literature10. Rapidly progressing pneumococcal sepsis with metabolic acidosis and disseminated intravascular coagulation has been reported in two adult individuals by Iinuma et al3. Analysis of the isolates revealed two interesting observations. Both the isolates that were responsible for fatal outcome belonged to non-vaccine serotypes i.e. 33C and 7C. The capsular polysaccharide-23 valent vaccine used for adult vaccination does not contain these two serotypes11,12. Studies in the West have shown that infections due to vaccine serotypes have declined in adults following vaccination of children with PCV-7 while non-vaccine serotypes causing invasive infections in high risk adults has risen13,14,15. In India, where pneumococcal vaccines have not been included in the routine immunization schedule in children, and adult vaccination is sporadic, and serotyping of invasive isolates remains a challenge. Routine typing to know the incidence of infections due to vaccine or non-vaccine serotypes both in children and adults, is not undertakn by most clinical laboratories across the country. Fatal infections caused by non-23 valent vaccine serotypes such as 33C and 7C of S. pneumoniae observed in this study raise the question on current strategies of adult pneumococcal vaccination. As the patients were healthy adults, preventive vaccination would not have played a role in protecting these individuals. Pathogenesis of invasive pneumococcal disease depends on both host inflammatory response as well as the organisms virulence. Several virulence factors have been incriminated in the pathogenesis of pneumococcal disease, including autolysin, pneumolysin (a key inducer of apoptosis) and pneumococcal surface adhesin A (PsaA)16. Capsular polysaccharide is the most commonly attributed factor. Pneumolysin is a cholesterol dependent cytolysin, that binds to cells and induces apoptosis17. Pneumolysin is known to reduce ciliary action, phagocytic function of polymorphonuclear cells and induce acute inflammatory reaction18. Both the isolates in this study were positive for genes coding for autolysin and pneumolysin. Though pbp gene was detected, penicillin resistance was not detected phenotypically, suggesting non-phenptypic expression of the gene. Our observation highlights two points. First, the involvement of non-vaccine serotypes in fatal invasive pneumococcal infection in adults. Some studies have shown a decline in adult pneumococcal disease following introduction of multi-valent pneumococcal conjugate vaccine in children13,18. But adult invasive infection and protecting the high risk groups still remains a major problem in several countries19. The US advisory committee on invasive pneumococcal disease (ACIP) has recommended the use of 23 valent polysaccharide vaccine (PPSV23) and the PCV13 (conjugate vaccine) for use in the elderly population aged >65 yr7,20. Secondly, could presence of pneumolysin and autolysin genes in the isolates obtained from these patients have any diagnostic or prognostic indications? Severity of pneumococcal pneumonia associated with bacterial genomic load determined by the copies of lytA genes has been reported21. In patients with no underlying risk factors, a strong suspicion of invasive pneumococcal disease with rapid assessment needs to be done to prevent grave outcome. A delay in treatment can occur in young and middle-aged patients, who are otherwise healthy leading to serious consequence. Accurate management in a timely manner can improve outcome. Rapid laboratory tests are essential for confirmatory diagnosis. A rapid diagnostic tool has been developed to detect pneumococcal antigen in urine and other body fluids which shows high sensitivity and specificity in adults19. The two isolates from our patients had the lytA and ply genes, although we did not attempt to detect this from the patients’ blood or body fluids. High level of clinical suscpicion with laboratory support by conventional blood culture, effective case management with appropriate antibiotics will decrease morbidity and mortality due to invasive pneumococcal disease in adults.