James N. Derr

mtDNA Affinities of the Peoples of North-Central Mexico

mtDNA haplotypes of representatives of the cosmopolitan peoples of north-central Mexico were studied. Two hundred twenty-three samples from individuals residing in vicinities of two localities in north-central Mexico were analyzed. A combination of strategies was employed to identify the origin of each haplotype, including length variation analysis of the COII and tRNALYS intergenic region, nucleotide sequence analysis of control region hypervariable segment 1, and RFLP analysis of PCR products spanning diagnostic sites. Analysis of these data revealed that the majority of the mtDNA haplotypes were of Native American origin, belonging to one of four primary Native American haplogroups. Others were of European or African origin, and the frequency of African haplotypes was equivalent to that of haplotypes of European derivation. These results provide diagnostic, discrete character, molecular genetic evidence that, together with results of previous studies of classical genetic systems, is informative with regard to both the magnitude of African admixture and the relative maternal contribution of African, European, and Native American peoples to the genetic heritage of Mexico. Phylogenetic analysis revealed that African sequences formed a basal, paraphyletic group.

HISTORICAL POPULATION SIZE CHANGE OF BOWHEAD WHALES INFERRED FROM DNA SEQUENCE POLYMORPHISM DATA

Abstract.— Nucleotide sequence data from the mitochondrial control region were used from a phylogenetic context to investigate the long‐term history of a population of bowhead whales (Balaena mysticetus). In addition, the coalescence time of these sequences was used to estimate the age of the inferred patterns of population size change. The results indicate that mitochondrial genetic polymorphism was not affected by a recent bottleneck that occurred near the turn of the 20th century, thereby preserving the signature of historical population size change in the mitochondrial genome. Further analysis showed that this population underwent an expansion initiated in the Middle to Late Pleistocene. As such, early Holocene changes in Arctic sea ice distribution appear to have had little influence on patterns of genetic variability in this population.

Evaluating a Putative Bottleneck in a Population of Bowhead Whales from Patterns of Microsatellite Diversity and Genetic Disequilibria

Abstract. A size-selected Balaena mysticetus genomic library was screened for clones containing simple sequence repeat, or microsatellite, loci. A total of 11 novel loci was identified. These loci were combined with a set of 9 published loci, for a total of 20 markers, and were scored across a sample of 108 bowhead whales from the Bering–Chukchi–Beaufort Seas population of bowhead whales. Genetic variability was measured in terms of polymorphism information content values and unbiased heterozygosity. From the latter, estimates of long-term effective population size were obtained. In addition, gametic phase disequilibrium among loci was investigated. Moderate to high levels of polymorphism were found overall, and the long-term effective size estimates were large relative to total population size. Tests of heterozygosity excess (Cornuet and Luikart 1996) and allele frequency distribution (Luikart et al. 1998) indicated that the possibility of a recent genetic bottleneck in the Bering–Chukchi–Beaufort Seas population of bowhead whales is highly unlikely. However, the fact that five loci displayed a statistically significant heterozygote deficiency remains to be explained.

Species-specific sequences at the omp2 locus of Brucella type strains.

A DNA sequence analysis of the omp2 locus of Brucella type strains revealed nucleotide differences that can be used for species identification. We developed specific probes which were used to verify the observed differences among the type strains following PCR amplification of portions of the omp2 locus.

Conservation genomics: disequilibrium mapping of domestic cattle chromosomal segments in North American bison populations.

Introgressive hybridization is one of the major threats to species conservation, and is often induced by human influence on the natural habitat of wildlife species. The ability to accurately identify introgression is critical to understanding its importance in evolution and effective conservation management of species. Hybridization between North American bison (Bison bison) and domestic cattle (Bos taurus) as a result of human activities has been recorded for over 100 years, and domestic cattle mitochondrial DNA was previously detected in bison populations. In this study, linked microsatellite markers were used to identify domestic cattle chromosomal segments in 14 genomic regions from 14 bison populations. Cattle nuclear introgression was identified in five populations, with an average frequency per population ranging from 0.56% to 1.80%. This study represents the first use of linked molecular markers to examine introgression between mammalian species and the first demonstration of domestic cattle nuclear introgression in bison. To date, six public bison populations have been identified with no evidence of mitochondrial or nuclear domestic cattle introgression, providing information critical to the future management of bison genetic resources. The ability to identify even low levels of introgression resulting from historic hybridization events suggests that the use of linked molecular markers to identify introgression is a significant development in the study of introgressive hybridization across a broad range of taxa.

Comparative PRNP genotyping of U.S. cattle sires for potential association with BSE

The recent discovery of significant associations between bovine spongiform encephalopathy (BSE) susceptibility in German cattle and the frequency distributions of insertion/deletion (indel) polymorphisms within the bovine PRNP gene prompted an evaluation of 132 commercial U.S. artificial insemination (AI) sires from 39 breeds. Forward primer sequences from published primer sets targeting indels within the putative bovine PRNP promoter, intron 1, and the 3′ UTR (untranslated region) were synthesized with unique 5′ fluorescent labels and utilized to develop a rapid multiplexed PCR assay for identifying BSE-associated indels as well as facilitating polymorphism analyses and/or marker-assisted selection. Significant differences (p < 0.05 all tests) were detected between the frequencies of bovine PRNP promoter alleles for 48 healthy German cattle previously described and 132 commercial U.S. cattle sires. The frequency of the 23-bp promoter allele observed for commercial U.S. cattle sires strongly resembled that recently described for 43 BSE-affected German cattle. No significant difference (p = 0.051) was detected between the distributions of promoter genotypes for healthy German cattle and our panel of commercial U.S. cattle sires. Interestingly, significant differences (p < 0.01; p < 0.02) were also noted between the frequencies and distributions of intron 1 alleles and genotypes, respectively, for BSE-affected German cattle and our panel of U.S. cattle sires. No significant allelic or genotypic differences were detected for the 14-bp 3′ UTR indel for any given comparison between German cattle and commercial U.S. cattle sires.

Variation and the phylogenetic utility of the large ribosomal subunit of mitochondrial DNA from the insect order Hymenoptera.

Nucleotide sequence variation from a 573-bp region of the mitochondrial 16S rRNA gene was determined for representative hymenopteran taxa. An overall bias in the distribution of A and T bases was observed from all taxa; however, the terebrants (parasitoids) displayed significantly lower AT ratios as well as a higher degree of strand asymmetry. Moreover, a strong positive correlation was observed between relative AT richness and sequence divergence, suggesting selection at the nucleotide level for A and T bases as well as functionality. Overall sequence difference ranged from 2.3 to 53.4%, with the maximum divergence between members of the two Hymenopteran suborders. These data were used in a phylogenetic analysis to illustrate the utility and degree of resolution provided by this information at various hierarchical levels within this taxonomically diverse order. Parsimony analysis revealed strong evidence for monophyly of the aculeates and the terebrants. Most noteworthy was a strongly supported clade containing the two terebrant superfamilies Icheumonoidea and Chalcidoidea. Conversely, high sequence divergence values resulted in instability at the base of the tree and limited resolution at the higher taxonomic levels. Nevertheless, these results do identify those taxonomic levels for which 16S rRNA sequences are phylogenetically informative.

CONSERVATION GENETIC ANALYSIS OF THE TEXAS STATE BISON HERD

Abstract The Texas State Bison Herd is directly descended from the herd assembled from 5 wild-caught bison by Charles Goodnight in the 1880s. In 1997, 36 bison were used to establish a herd at Caprock Canyons State Park. To aid in the development of a long-term genetic conservation plan for this population, we examined and analyzed allelic variation at 54 microsatellite loci representing each of the nuclear chromosomes in the bison genome. The current Texas State Bison Herd population exhibits low genetic diversity and heterozygosity levels compared with bison at Yellowstone National Park and Theodore Roosevelt National Park. Parentage analysis indicates that relatively few adults have contributed offspring in the last 5 years, leading to low effective population size estimations and a rapid increase in the average age of animals in the herd. The very limited number of original founders, multiple population bottlenecks over the last 120 years, and chronically small population size, coupled with genetic drift and inbreeding, have resulted in dangerously low levels of genetic diversity. This, in turn, has likely triggered demographic problems such as low recruitment and high calf mortality rates. Population viability analysis based on current population demography reveals that there is a 99% chance of extinction of the herd within the next 41 years. Based on these findings, the continued existence of this historically important bison population appears doubtful without the introduction of new genetic variation from another plains bison herd.

Complete mitochondrial DNA sequence analysis of Bison bison and bison-cattle hybrids: Function and phylogeny

Complete mitochondrial DNA (mtDNA) genomes from 43 bison and bison-cattle hybrids were sequenced and compared with other bovids. Selected animals reflect the historical range and current taxonomic structure of bison. This study identified regions of potential nuclear-mitochondrial incompatibilities in hybrids, provided a complete mtDNA phylogenetic tree for this species, and uncovered evidence of bison population substructure. Seventeen bison haplotypes defined by 66 polymorphic sites were discovered, whereas 728 fixed differences and 86 non-synonymous mutations were identified between bison and bison-cattle hybrid sequences. The potential roles of the mtDNA genome in the function of hybrid animals and bison taxonomy are discussed.

Reassessment of the 16S rRNA nucleotide sequence from members of the parasitic hymenoptera

Recently we examined the phylogenetic utility of the large ribosomal subunit of mitochondrial DNA from the insect order Hymenoptera (Derr et al. 1992). That study included nucleotide sequence information for members of six superfamilies from the two hymenopteran suborders (Symphyta and Apocrita). After submitting the manuscript for publication we discovered an error regarding some of the sequences in our original report. By the time the problem was resolved the manuscript was in press and we could not prevent publication. The incorrect sequences were all from the terebrant (“parasitic Hymenoptera”) group and consisted of sequences from three members of the superfamily Ichneumonoidea (Xanthopimpla stemmator, Digonogastra kimballi, and Allorhogas pyralophagus) and sequences from two representatives of the superfamily Chalcidoidea (Aphytis yanonensis and A. lingnanensis). In this report we provide the correct nucleotide sequence for four members of the parasitic group along with a reanalysis of this gene region. In addition, we offer suggestions on how to prevent reporting spurious nucleotide sequence when limited amounts of comparative data are available. We suspect that samples used in our original analyses were contaminated with small amounts of vertebrate DNA through the aqueous phase layered above the phenol used in the phenol-chloroform DNA extraction. We therefore eliminated this step when extracting new genomic DNAs by using a commercially available glass bead DNA purification kit (Schleicher & Schuell). This procedure eliminated the organic extraction/ethanol precipitation step and provided excellent template DNA for PCR amplification. In our original studies template DNAs from all parasitic Hymenoptera failed to amplify due to a nucleotide substitution corresponding to the 3’ end of one “conserved” PCR primer. Therefore, we designed two new pairs of PCR primers that border this region of the 16s rRNA gene. The first primer pair, 16Al and 16B1, are identical to the original primers 16SA and 16SB (Derr et al., 1992) except a single base was deleted at each of the 3’ ends (Fig. 1). Although these primers amplified the appropriate size fragment from the new DNA samples, we could not be sure that this product was not an additional contaminant. In order to ensure that PCR amplifications were limited to insect templates, we constructed an additional primer pair that ended on 3’ positions that consistently differed between insect and vertebrate 16s rRNA sequences. Details of the placement of the A primers are provided in Fig. 1. The sequences of these “taxonomitally limited” primers are as follows: 16A2AGATTTTAAAAGTCGAACAGAClCTlTAA and 16B2 -CGCCTGTTTATCAAAAACATGT. PCR, DNA sequencing, sequence alignment, and the phylogenetic analysis were as reported earlier (Derr et al., 1992). With the use of the primers 16A2 and 16B2, nucleotide sequences were determined from both DNA strands from four members of the superfamily Ichneumonoidea. These included one individual from the family Ichneumonidae (Xunthopimplu stemmator) and three from the family Braconidae (Digonogustra kim-