Jesús Méndez-Lozano

Detection of white spot syndrome virus in filtered shrimp-farm water fractions and experimental evaluation of its infectivity in Penaeus (Litopenaeus) vannamei.

Detection of white spot syndrome virus in filtered shrimp-farm water fractions and experimental evaluation of its infectivity in Penaeus (Litopenaeus) vannamei Héctor M. Esparza-Leal , César M. Escobedo-Bonilla , Ramón Casillas-Hernández , Píndaro Álvarez-Ruíz , Guillermo Portillo-Clark , Roberto C. Valerio-García , Jorge Hernández-López , Jesús Méndez-Lozano , Norberto Vibanco-Pérez , Francisco J. Magallón-Barajas d,⁎

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of

Prevalence of viral pathogens WSSV and IHHNV in wild organisms at the Pacific Coast of Mexico

259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

First report of Alternaria alternata (Fr.) Keissler causing inflorescence blight in Jatropha curcas in Sinaloa, Mexico

This study investigated whether white spot syndrome virus and Infectious hypodermal and hematopoietic necrosis virus, can survive in wild invertebrates and vertebrates in the environment surrounding shrimp farms along the Pacific coast of Mexico. The evidences imply that both viruses have a potential of persisting in crabs, blue, white and brown shrimps. The most prevalent virus, IHHNV was present in 19.5% (344/1736) followed by WSSV in 3.6% (65/1736). Coinfection of WSSV and IHHNV was also detected in crabs, blue and white shrimps. This is the first prevalence report of WSSV and IHHNV associated with wildlife species in Mexico.

Detection and quantification of ‘Candidatus Phytoplasma asterisʼ and ‘Candidatus Liberibacter asiaticusʼ at early and late stages of Huanglongbing disease development

Abstract A new fungal disease of inflorescences of Mexican nut (Jatropha curcas L.) was found on plants in two experimental fields located in Sinaloa, Mexico during summer 2011. The fungus caused inflorescence blight on flowers with typical symptoms of dark brown necrotic lesions; both plantations of J. curcas had disease incidence of 50–60%. Based on cultural and morphological characteristics and ribosomal DNA spacer sequences, the pathogen was identified as Alternaria alternata (Fr.) Keissler. To our knowledge, this is the first report of Alternaria inflorescence blight disease in J. curcas in Mexico.

First report of pepper as a natural new host for Tomato marchitez virus in Sinaloa, Mexico

Abstract ʻCandidatus Phytoplasma asterisʼ (CPa) has been identified along with ʻCandidatus Liberibacter asiaticusʼ (CLas) from citrus trees showing Huanglongbing (HLB) symptoms in Mexico. The low titre of CPa and CLas in infected plants is the major constraint to developing an accurate and sensitive method for their detection that would support an effective HLB diagnosis and management programme. This investigation reports the development and validation of a new TaqMan quantitative PCR to detect low titres of CPa in citrus trees with HLB symptoms based on the phytoplasma 16S rRNA gene region. The assay was used to monitor the titre of CPa at early and late stages of disease development in symptomatic and asymptomatic Mexican lime trees in Colima, Mexico. The concentration of CLas was determined by nested-qPCR. Only eight out of 39 sampled branches showed HLB symptoms at the early infection stage. All 39 branches were symptomatic at the late infection stage. The qPCR yielded an increase in the branch incidence and concentration of CLas (49 to 100% and 5 × 103 to 12 × 103 cells/100 ng of total DNA), while CPa showed a decreased incidence and concentration (72to 41% and 199 to 19 cells/100 ng of total DNA) throughout the disease development. Results confirm the occurrence of mixed infection of CLas and CPa in HLB-affected citrus trees, although their epidemiological role in co-infecting remains unknown.

‘Candidatus Phytoplasma asteris’ is associated with citrus “huanglongbing” disease in Mexico

Abstract Tomato marchitez virus (ToMarV) was observed infecting pepper as a natural new host in Sinaloa, Mexico during the annual growth season (September 2010 to May 2011). Symptoms typical of viral infection consisted of yellow mosaic, upward leaf curling, crinkling, and stunting. The presence of whiteflies was observed on the affected plants, indicating possible vectors of the virus. Samples from symptomatic plants tested negative for the presence of viruses in the genera Begomovirus and Crinivirus, both of which are whitefly-transmitted. The results from RT-PCR and sequencing analysis indicated that ToMarV (genus Torradovirus) was present in six out of 15 samples. Subsequently, sap from infected leaves was used to successfully transmit the virus by mechanical inoculation to three pepper cultivars. This is the first report of Tomato marchitez virus infection on pepper in Mexico.

Genetic Diversity and Geographical Distribution of Phytoplasmas Associated with Potato Purple Top Disease in Mexico

“Huanglongbing” is one of the most devastating citrus diseases worldwide. ‘Candidatus Liberibacter’ and ‘Candidatus Phytoplasma’ species are commonly associated with the disease, although phytoplasmas were only found in citrus showing “huanglongbing”-like symptoms in Brazil and China. In Mexico samples were evaluated ‘Ca. L. asiaticus’ and ‘Ca. Phytoplasma’ presence by PCR assays. Fifty-four out of 86 citrus plants were positive for ‘Ca. L. asiaticus’, 20 were positive for ‘Ca. Phytoplasma’ and 7 were found as hosts of mixed infections with both prokaryotes. RFLP analyses of the 16S rDNA sequences enabled to identify two of the phytoplasma strains as members ‘Candidatus Phytoplasma asteris’ subgroups 16SrI-B and 16SrI-S. Moreover partial ‘Ca. L. asiaticus’ sequences were identical to those of strains from countries affected by “huanglongbing” disease. These results confirm the association of ‘Ca. Phytoplasma’ with “huanglongbing” in citrus in Mexico, and its occurrence in mixed infections with ‘Ca. L. asiaticus’.