Jill Williamson

Hepatocytes from non-hepatic adult stem cells

Stem cells are undifferentiated long-lived cells that are capable of many rounds of division. Here we show that adult human liver cells can be derived from stem cells originating in the bone marrow or circulating outside the liver, raising the possibility that blood-system stem cells could be used clinically to generate hepatocytes for replacing damaged tissue.

Cell differentiation: Hepatocytes from non-hepatic adultstem cells

Stem cells are undifferentiated long-lived cells that are capable of many rounds of division. Here we show that adult human liver cells can be derived from stem cells originating in the bone marrow or circulating outside the liver, raising the possibility that blood-system stem cells could be used clinically to generate hepatocytes for replacing damaged tissue.

Polyclonal Origin of Colonic Adenomas in an XO/XY Patient with FAP

It is widely accepted that tumors are monoclonal in origin, arising from a mutation or series of mutations in a single cell and its descendants. The clonal origin of colonic adenomas and uninvolved intestinal mucosa from an XO/XY mosaic individual with familial adenomatous polyposis (FAP) was examined directly by in situ hybridization with Y chromosome probes. In this patient, the crypts of the small and large intestine were clonal, but at least 76 percent of the microadenomas were polyclonal in origin.

Novel Breast Cancer Susceptibility Locus at 9q31.2: Results of a Genome-Wide Association Study

BACKGROUND Genome-wide association studies have identified several common genetic variants associated with breast cancer risk. It is likely, however, that a substantial proportion of such loci have not yet been discovered. METHODS We compared 296,114 tagging single-nucleotide polymorphisms in 1694 breast cancer case subjects (92% with two primary cancers or at least two affected first-degree relatives) and 2365 control subjects, with validation in three independent series totaling 11,880 case subjects and 12,487 control subjects. Odds ratios (ORs) and associated 95% confidence intervals (CIs) in each stage and all stages combined were calculated using unconditional logistic regression. Heterogeneity was evaluated with Cochran Q and I(2) statistics. All statistical tests were two-sided. RESULTS We identified a novel risk locus for breast cancer at 9q31.2 (rs865686: OR = 0.89, 95% CI = 0.85 to 0.92, P = 1.75 × 10(-10)). This single-nucleotide polymorphism maps to a gene desert, the nearest genes being Kruppel-like factor 4 (KLF4, 636 kb centromeric), RAD23 homolog B (RAD23B, 794 kb centromeric), and actin-like 7A (ACTL7A, 736 kb telomeric). We also identified two variants (rs3734805 and rs9383938) mapping to 6q25.1 estrogen receptor 1 (ESR1), which were associated with breast cancer in subjects of northern European ancestry (rs3734805: OR = 1.19, 95% CI = 1.11 to 1.27, P = 1.35 × 10(-7); rs9383938: OR = 1.18, 95% CI = 1.11 to 1.26, P = 1.41 × 10(-7)). A variant mapping to 10q26.13, approximately 300 kb telomeric to the established risk locus within the second intron of FGFR2, was also associated with breast cancer risk, although not at genome-wide statistical significance (rs10510102: OR = 1.12, 95% CI = 1.07 to 1.17, P = 1.58 × 10(-6)). CONCLUSIONS These findings provide further evidence on the role of genetic variation in the etiology of breast cancer. Fine mapping will be needed to identify causal variants and to determine their functional effects.

Mutation Cluster Region, Association Between Germline and Somatic Mutations and Genotype-Phenotype Correlation in Upper Gastrointestinal Familial Adenomatous Polyposis

Studies of adenomatous polyposis coli (APC) mutations in familial adenomatous polyposis (FAP) have focused on large bowel disease. It has been found that: 1) germline APC mutations around codon 1300 are associated with severe colorectal polyposis; 2) somatic APC mutations in colorectal tumors tend to cluster approximately between codons 1250 and 1450; and 3) patients with germline mutations close to codon 1300 tend to acquire somatic mutations (second hits) in their colorectal polyps by allelic loss, whereas the tumors of other FAP patients have truncating second hits. Using new and published data, we have investigated how germline and somatic APC mutations influence the pathogenesis of upper gastrointestinal polyps in FAP. We have compared the results with those from colorectal disease. We found that somatic mutations in upper gastrointestinal polyps cluster approximately between codons 1400 and 1580. Patients with germline APC mutations after codon 1400 tend to show allelic loss in their upper gastrointestinal polyps; the tumors of other patients have truncating somatic mutations after codon 1400. Finally, patients with germline mutations after codon 1400 tend to have more severe duodenal polyposis (odds ratio, 5.72; 95% confidence interval, 1.13 to 28.89; P = 0.035). Thus, in both upper gastrointestinal and colorectal tumors, a specific region of the APC gene is associated with severe disease, clustering of somatic mutations, and loss of the wild-type allele. However, the region concerned is different in upper gastrointestinal and colorectal disease. The data suggest that loss of all APC SAMP repeats is probably necessary for duodenal and gastric tumorigenesis in FAP, as it is in colonic tumors. Compared with colonic tumors, however, retention of a greater number of beta-catenin binding/degradation repeats is optimal for tumorigenesis in upper gastrointestinal FAP.

The Breakthrough Generations Study: design of a long-term UK cohort study to investigate breast cancer aetiology.

Background:The rationale, design, recruitment and follow-up methods are described for the Breakthrough Generations Study, a UK cohort study started in 2003, targeted at investigation of breast cancer aetiology.Methods:Cohort members have been recruited by a participant referral method intended to assemble economically a large general population cohort from whom detailed questionnaire information and blood samples can be obtained repeatedly over decades, with high completeness of follow-up and inclusion of large numbers of related individuals. ‘First-generation’ recruits were women contacted directly, or who volunteered directly, to join the study. They nominated female friends and family, whom we contacted, and those who joined (‘second generation’) nominated others, reiterated for up to 28 generations.Results:The method has successfully been used during 2003–2011 to recruit 112 049 motivated participants with a broad geographic and socioeconomic distribution, aged 16–102 years, who have completed detailed questionnaires; 92% of the participants gave blood samples at recruitment. When eligible, 2½ years after recruitment, >98% completed the first follow-up questionnaire. Thirty percent are first-degree relatives of other study members.Conclusion:The ‘generational’ recruitment method has enabled recruitment of a large cohort who appear to have the commitment to enable long-term continuing data and sample collection, to investigate the effects of changing endogenous and exogenous factors on cancer risk.

CYP3A Variation, Premenopausal Estrone Levels, and Breast Cancer Risk

BACKGROUND Epidemiological studies have provided strong evidence for a role of endogenous sex steroids in the etiology of breast cancer. Our aim was to identify common variants in genes involved in sex steroid synthesis or metabolism that are associated with hormone levels and the risk of breast cancer in premenopausal women. METHODS We measured urinary levels of estrone glucuronide (E1G) using a protocol specifically developed to account for cyclic variation in hormone levels during the menstrual cycle in 729 healthy premenopausal women. We genotyped 642 single-nucleotide polymorphisms (SNPs) in these women; a single SNP, rs10273424, was further tested for association with the risk of breast cancer using data from 10 551 breast cancer case patients and 17 535 control subjects. All statistical tests were two-sided. RESULTS rs10273424, which maps approximately 50 kb centromeric to the cytochrome P450 3A (CYP3A) gene cluster at chromosome 7q22.1, was associated with a 21.8% reduction in E1G levels (95% confidence interval [CI] = 27.8% to 15.3% reduction; P = 2.7 × 10(-9)) and a modest reduction in the risk of breast cancer in case patients who were diagnosed at or before age 50 years (odds ratio [OR] = 0.91, 95% CI = 0.83 to 0.99; P = .03) but not in those diagnosed after age 50 years (OR = 1.01, 95% CI = 0.93 to 1.10; P = .82). CONCLUSIONS Genetic variation in noncoding sequences flanking the CYP3A locus contributes to variance in premenopausal E1G levels and is associated with the risk of breast cancer in younger patients. This association may have wider implications given that the most predominantly expressed CYP3A gene, CYP3A4, is responsible for metabolism of endogenous and exogenous hormones and hormonal agents used in the treatment of breast cancer.

cDNA cloning and chromosomal mapping of a mouse gene with homology to NTPases

Nucleoside-triphosphatases (NTPases) are divalent cation-depen-dent transmembrane glycoproteins that hydrolyze extracellularnucleoside tri-and/or diphosphates (for review see Plesner 1995).Several functional roles of NTPases have been proposed, in-cluding the termination of purinergic signaling, cellular adhesion,vesicular transport, purine recycling, and regulation of ecto-kinases by control of substrate concentration (Plesner 1995; Stro-bel and Rosenberg 1993; Kittel and Bacsy 1994).NTPases have been identified in a broad spectrum of organ-isms including human, mouse, chicken, garden pea, potato, Sac-charomyces cerevisiae, C. elegans, and T. gondii.We have cloned a novel mouse family member by low-stringency screening of mouse cDNA libraries with a humanCD93L1 cDNA clone (Chadwick and Frischauf 1997). A 1738-bpcDNA clone was isolated from an adult mouse testis cDNA library(Stratagene Ltd., Cambridge, UK) and sequenced. DNA sequencecomparisons with the human CD39L1 cDNA sequence showedmoderate DNA homology (39% identity). An open reading frame(ORF) could be detected for the cDNA sequence, but indicated thatthe cDNA clone did not contain the initiation methionine codonand therefore did not extend to the 58 end. Database searches withthe mouse cDNA sequence identified two mouse EST clones thatextended the cDNA sequence at the 58 end (Accession numbersAA116990 and AA120757). The EST clones were resequenced,and the combined DNA sequence (Acc. No. AF006482) showedan ORF from nucleotides 205 to 1599, with the ATG at nucleotide205 having a moderate match to the initiation start site for verte-brates (AAGAAUAUGG for mNTPase versus GCCGCCAUGG)(Kozak 1989). No apparent polyadenylation signal exists, althoughthe cDNA clone contains a poly-A tail. Hydrophobicity plots withTopred-II 1.1 (Claros and Von Heijne 1994) predict a single po-tential transmembrane segment close to the amino terminus of theprotein, suggesting a single-pass transmembrane protein with alarge extracellular domain. Two potential N-glycosylation sitescan be found at amino acid positions 41 (NVSA) and at 231(NSTF), suggesting that mNTPase is glycosylated. Databasesearches with the predicted protein sequence identified consider-able homology to other members of the NTPase family. Figure 1shows an alignment of the full protein sequence of mNTPaseagainst three of the most homologous known NTPases from gar-den pea (Acc. No. S48859), potato (Acc. No. U58597), and Sac-charomyces cerevisiae (Acc. No. L19560). The mNTPase proteinshares more than 30% amino acid identity with the three otherNTPases.The region of highest homology between all members of theNTPase family is at the amino terminus of the protein. Handa andGuidotti (1996) highlighted four regions of NTPases known asputative apyrase-conserved regions (ACRs). Figure 2 shows analignment of ACRs I–IV. The high level of conservation of theACRs would indicate that these regions are essential for the func-tioning of the protein, while changes in the regions surroundingthese domains can be tolerated. It may be evolutionary changes inthe flanking residues that are responsible for the variation in sub-strate and kinetics of the different proteins. The presence of all fourACRs in the mNTPase protein suggests that mNTPase is a newmember of the NTPase family. This would be the third member ofthe mouse NTPase family alongside the lymphoid cell activationantigen, cd39, and the recently identified cd39-like-1 gene,cd39L1. BLAST searches with the DNA sequence of mNTPaserevealed two overlapping human EST clones with 57% DNA se-quence identity to mNTPase (Acc. No. H08436 and AA378537).An ORF can be found for the human ESTs that shows homologyto NTPases. The putative NTPase protein sequence, namedCD39L2, is shown in Fig. 2 alongside the other NTPase genes. Thepresence of the ACRs in the partial human CD39L2 protein showsthat another human NTPase gene exists, which could be the humanhomolog of mNTPase. The human and mouse CD39 proteins sharemore than 90% amino acid identity, while the CD39L1 proteinfrom human and mouse share more than 87% amino acid identity.An alignment of the mNTPase amino acid sequence against thepartial CD39L2 amino acid sequence shows only 60% amino acididentity, but certain residues absent from the CD39L1 and CD39proteins are present in both CD39L2 and mNTPase proteins. IfCD39L2 is not the human homolog of the mNTPase protein, thenthis would indicate that a minimum of four NTPase genes possiblyexist in humans: CD39, CD39L1, CD39L2, and the human homo-log of mNTPase.To map the mouse-NTPase gene, a cosmid was isolated froma mouse cosmid library (Frischauf, unpublished), and used forfluorescence in situ hybridization (FISH). Figure 3 shows the pres-ence of mNTPase on mouse Chr 12 at chromosome band E. Toconfirm the location of mNTPase on mouse Chr 12, linkage analy-sis was carried out upon the European Collaborative InterspecificBackcross (EUCIB). PCR primers were designed to the 38 untrans-lated region of the mNTPase cDNA sequence and used for PCR byuse of mouse genomic DNA from the two parental mouse strains,Mus spretus and C57BL/6. A polymorphism was detected betweenthe two strains by SSCP and used for the mapping. (Primer 1:CCAGACTGTAAATCTTTTGG : Primer 2: AGGGAATG-TAATAAGGGTAG : 94°C 2 min: 35 cycles of 94°C 20 s, 48°C20 s, 72°C 20 s; 72°C min. Product size, 320 bp). Linkage with aLOD score of 8.14 was obtained with the genetic marker D12Mit4,flanked by D12Mit149 and D12Mit238, between 31.7 cM and 36.1cM from the top of the mouse Chr 12 linkage group for the MITF

Hepatocytes from non-hepatic adult stem cells: Cell differentiation

Stem cells are undifferentiated long-lived cells that are capable of many rounds of division. Here we show that adult human liver cells can be derived from stem cells originating in the bone marrow or circulating outside the liver, raising the possibility that blood-system stem cells could be used clinically to generate hepatocytes for replacing damaged tissue.