Jiří Schwarz

Prognostic impact of DNMT3A mutations in patients with intermediate cytogenetic risk profile acute myeloid leukemia

Objectives: Recently, mutations in DNMT3A gene have been described in about 25% acute myeloid leukemia (AML) cases, preferentially in monocytic AML. They were found to predict worse overall survival (OS) of mutated patients. Patients and methods: RT‐PCR followed by direct sequencing was used to test the presence of DNMT3A mutations in 226 AML patients with an intermediate‐risk (IR) cytogenetics. Results: Sixty‐seven patients of 226 (29.6%) carried a mutation in the DNMT3A gene. Occurrence of DNMT3A mutations was associated with female sex (P = 0.027) and with the presence of FLT3/ITD (P = 0.003), but not with particular FAB subtypes. Patients with DNMT3A mutation had higher initial WBC counts than those without it (P = 0.064) only because of higher incidence of FLT3/ITD within these cases. There was no difference between mutated and wild‐type groups in reaching complete remission (CR) (P = 0.380). OS was not affected by DNMT3A mutation (P = 0.251), but OS of patients who reached CR was longer in DNMT3A negative cases (P = 0.025). Patients with DNMT3A mutation had a higher relapse rate (P = 0.007). Patients carrying both the DNMT3A mutation and FLT3/ITD relapsed more often than either patients with single DNMT3A mutation (P = 0.044) or patients with FLT3/ITD only (P = 0.058). DNMT3A mutations were associated with higher relapse rate even within the FLT3/ITD‐negative group (P = 0.072). After reaching CR, these two genetic factors were independent predictors of relapse at multivariate analysis (P < 0.001). Only three of 30 ‘double‐mutated’ (FLT3/ITD+, DNMT3A+) patients are still alive, all of them having undergone hematopoietic stem cell transplant. Conclusions: We have confirmed the high incidence of DNMT3A mutations in patients with AML with IR cytogenetics. Patients with DNMT3A mutations relapse more often and have inferior OS when only patients achieving CR are analyzed. ‘Double‐mutated’ patients have a very poor prognosis.

Monitoring of minimal residual disease in patients with core binding factor acute myeloid leukemia and the impact of C-KIT, FLT3, and JAK2 mutations on clinical outcome.

Mutational analysis of C-KIT, fms-like tyrosine kinase 3 (FLT3), and JAK2 genes was performed in 60 patients with core binding factor acute myeloid leukemia (CBF-AML). Patients reaching molecular remission had lower incidence of relapse and better overall survival (OS) than those not achieving molecular remission (p = 0.008 and 0.044, respectively). The overall incidence of C-KIT mutations was 33.3%, FLT3/internal tandem duplication (ITD) 6.6%, FLT3D835 10.0% and JAK2V617F mutations 3.3%. C-KIT mutations did not predict for clinical/molecular relapse (p = 0.33). OS of patients with C-KIT mutations was identical to patients without them when all patients with CBF-AML were analyzed together (p = 0.58). When AML1/ETO-positive patients were evaluated separately, OS in C-KIT-mutated patients was slightly inferior to unmutated ones (p = 0.14). Patients with CBF-AML with a mutated C-KIT gene were also more prone to extramedullary disease (p = 0.08). Of six patients harboring various FLT3D835 mutations, four (66.7%) relapsed, whereas among 43 cases without these mutations, 16 relapses (37%) were observed (p = 0.08). Our results on minimal residual disease, C-KIT, and FLT3/ITDs are in line with previous studies. Surprisingly, a possible role for FLT3D835 mutations was noted in addition. These results need validation in even larger patient cohorts than ours. For routine clinical practice, it may be meaningful to screen for C-KIT mutations in AML1/ETO-positive patients, as well as for FLT3D835 mutations in CBF-AML.

Touch-Down Reverse Transcriptase-PCR Detection of IgV H Rearrangement and Sybr-Green-Based Real-Time RT-PCR Quantitation of Minimal Residual Disease in Patients with Chronic Lymphocytic Leukemia

AbstractBackground: Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. Aim: The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable IgVH rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. Methods: As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of h gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgVH sequences were cloned. Results: Touch-down RT-PCR with degenerate primers allowed the successful detection of IgVH clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10−6. We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic ‘mini’-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Conclusions: Our touch-down RT-PCR has higher efficiency to detect clonal IgVH rearrangements including the biallelic ones. MRD quantitation of IgVH expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

Modern and conventional prognostic markers of chronic lymphocytic leukaemia in the everyday haematological practice

Objectives: The impact of modern prognostic markers on clinical course of chronic lymphocytic leukaemia (CLL) in everyday practice has been not yet well defined, especially in large series of patients. Therefore, the goal of this study was to assess the influence of conventional as well as modern prognostic factors on overall survival (OS) and time to therapy (TTT) of patients with CLL. Methods: We retrospectively analysed data of all patients consecutively entered into the databases of five large academic centres in the Czech Republic. The total of 1300 patients was included in the analysis. Results and conclusion: Through the use of uniparametric analysis, it was determined that gender, clinical stage Rai II–IV, unmutated IgVH status, deletion 17p (for both 5% and 20% cut‐off), deletion 11q, ZAP‐70 positivity and high expression of CD38 had significant negative influence on OS. TTT was significantly influenced by gender, Rai stage, IgVH status, deletion 11q, deletion 17p, deletion 13q and CD38 expression. Multiparametric analysis revealed that OS was significantly influenced by gender, age, IgVH status and deletion 17p. If only patients who died of CLL were included, gender, age, Rai stage, IgVH status and deletion 17p had significant influence on OS. Based on our results, the examination of biological prognostic markers can give an insight into the possible disease evolution in daily clinical practice. Biological prognostic markers are, however, not ready (maybe except deletion 17p in younger patients) to be used for guidance of therapy at least outside of clinical trials.

Thrombosis in thrombocythemic Ph-myeloproliferations is associated with higher platelet count prior to the event: results of analyses of prothrombotic risk factors from a registry of patients treated with anagrelide

Controversies still exist regarding definition of the thrombotic risks in Ph‐ (BCR/ABL1‐) myeloproliferative disorders with thrombocythemia (MPD‐T). Platelet counts at diagnosis are currently not taken as a risk factor of thrombosis. In our cohort of 1179 patients with MPD‐T, prospectively registered for anagrelide treatment, we found that the median platelet count prior to the thrombotic event was significantly higher than at time points without any ensuing thrombosis (453 vs. 400 × 109/L, P < 0.001), albeit higher platelet counts at diagnosis tended to be connected with fewer thrombotic events (in contrast to WBC counts at diagnosis). The JAK2V617F mutation predicted both arterial and venous events, while age >65 yr, hypertension, diabetes mellitus, smoking, elevated triglyceride and homocysteine levels predicted arterial events only. For venous events, the specific thrombophilic risk factors (factor V ‘Leiden’ and others), antiphospholipid antibodies, and elevated factor VIII levels played a major role. During anagrelide treatment (± aspirin), we documented a decrease in both venous (6.7‐fold) and arterial events (1.8‐fold), while bleeding (mostly minor events) increased twofold compared to history. Our results suggest that keeping platelet counts at low levels may be a meaningful therapeutic measure to prevent thrombosis, although their counts at diagnosis lack any prognostic value.

A new allelic discrimination assay using locked nucleic acid-modified nucleotides (LNA) probes for detection of JAK2 V617F mutation

Discovery of an acquired mutation in the Janus kinase 2 (JAK2 V617F) in patients with Philadelphia chromosome negative (Ph-) myeloproliferative diseases (MPD) was reported by multiple groups of authors in 2005 [1]. The presence of the mutation confirms clonality in MPD, and according to some authors, it may be relevant even prognostically [2]. The reported proportions of patients carrying this mutation are highly variable, depending on the respective MPD entity and on the sensitivity of the method used for its detection [3]. The newly developed allelic discrimination assay that we wish to report on is based on real-time RTPCR [4,5]. It is very simple, high throughput and enables detection of 2% of the mutated allele. It uses two dual labelled TaqMan probes with locked nucleic acid (LNA)-modified nucleotides. LNA is a nucleic acid analog that contains a 20-O, 40-C methylene bridge. This bicyclic structure locks the ribose group into a C30-endo conformation. Introduction of LNA monomers into oligonucleotides increases thermal stability of heteroduplexes within þ3/þ88C per modification. This translates in increased specificity of the allelic discrimination [6]. The probes differ at the polymorphic site; one of them is complementary to the wild-type JAK2 allele and the other to the mutated one. Each probe is labelled with a different reporter dye on its 50-end (6-carboxyfluorescein (FAM) for the probe complementary to the wild type allele, 2,7-dimethoxy-4,5dichloro-6-carboxyfluorescein (JOE) for the mutant one in our hands) and a black hole quencher dye (BHQ1) is attached to the 30-end of both the probes. During PCR cycling, the probes specifically hybridize to the targeted sequences (mutated and wild type, respectively). Then the Taq polymerase cleaves the probe with its 50-30 nuclease activity, so that the reporter dye and quencher dye become separated [Figure 1(A)]. This leads to an increase of fluorescence intensity. Patients homozygous for the JAK2 mutation show only JOE signal, whereas increase of only the FAM signal indicates wild type homozygous genotype. Heterozygous patients show various ratios of both signals. To verify the results obtained by our new method, all samples were tested by the common allelespecific (AS)-PCR developed by Baxter et al. [7]. Peripheral blood samples from 261 patients with already diagnosed or suspected Ph-MPD were obtained. Patients with WHO-defined polycythaemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (IMF) were included in the study, as well as patients with undifferentiated MPD (MPD-U), secondary polyglobulia (SP) and secondary thrombocytosis (ST). Mononuclear cells from peripheral blood were removed using Histopaque1077 (Sigma – Aldrich, St. Louis, MO) density gradient, and erythrocytes were lysed using red cell lysis solution (155 mmol NH4Cl, 10 mmol NH4HCO3, 0.1 mmol EDTA) in order to obtain relatively pure granulocytes. The contamination by other cells was estimated in smears of the separated cells and routinely did not exceed 10%. This granulocyte-rich cell fraction was washed twice with phosphate-buffered saline (137 mmol NaCl, 2.7 mmol KCl, 4.3 mmol Na2HPO4 7H2O, 1.4 mmol KH2PO4), and aliquots of 56 10 6 cells

The effect of allogeneic stem cell transplantation on high risk chronic lymphocytic leukaemia: a single centre retrospective analysis

In recent years, many studies have confirmed that allogeneic stem cell transplantation (allo‐SCT) can provide long‐term disease control and possible cure in selected patients with chronic lymphocytic leukaemia (CLL), including those with a biologically highly unfavourable risk profile. A retrospective analysis of allo‐SCT in 30 patients with CLL whose risk profile was unfavourable and who were treated in the years 2000–2009 was performed. The aim was to compare the results of allo‐SCT by prognostic factors and conditioning type and evaluate the results of unrelated transplantation. The median age was 54 years. Donors were 8 HLA‐matched siblings and 22 unrelated volunteers, 11 of whom were mismatched. Eighteen patients were treated with reduced intensity conditioning. Twelve patients received myeloablative conditioning. Estimated overall survival (OS) at 3 years was 78%, progression‐free survival (PFS) 71%, relapse incidence 10% and non‐relapse mortality (NRM) 16%, respectively, with a median follow‐up of 35 months. According to molecular/cytogenetic characteristics, OS and PFS for the high risk group (17p‐ or 11q‐) were 89 and 77%, respectively, not significantly different from those with standard risk. Graft‐versus‐host disease (GVHD) was associated with greater toxicity; significantly higher NRM for patients with aGVHD (p = 0.04) and worse PFS for patients with cGVHD (p = 0.04). Our results for the refractory disease group (77% responses) indicate that chemoresistance may be overcome by the GVL effect. Transplants from unrelated donors may be considered comparable to those from related donors. Copyright

Features of immaturity in cells derived from granulocytic differentiation inducer treated human myeloid leukaemia (ML-1) cells

Cells of the human myeloid leukaemia cell line ML-1 were exposed to differentiation inducing doses of dimethylsulfoxide (DMSO) and retinoic acid (RA). DMSO (but not RA) caused an inhibition of cell growth which was reversible. Some granulocytic maturation associated changes were induced by both agents: nuclear segmentation in 10-20% of cells, B43.4 antigen positivity. In contrast, several other markers were not induced: nucleoli persisted in almost 100% cells including the segmented ones, the nuclear membrane regions did not stain with Victoria blue B (which stains these regions in normal neutrophils), the expression of other antigens of mature neutrophils was also not induced. Maturation asynchrony and non-physiological segmentation of round and oval nuclei were observed. Examination of nucleoli on a single cell level revealed a reversible decrease of pre-rRNA synthesis in 28-48% of the induced cells. These results indicate that terminal differentiation did not occur and confirm the dissociation in induction of various differentiation markers.

N-terminally truncated WT1 variant (sWT1) is expressed at very low levels in acute myeloid leukemia and advanced phases of chronic myeloid leukemia.

The Wilms’ tumour gene 1 (WT1) encodes a multifunctional proein important for regulation of cell growth and survival. It plays role in many physiological developmental processes and also n cancers including leukemia. WT1 is overexpressed in most of eukemias and therefore it is sometimes even called a “panleukemic arker”. Total WT1 expression level is used in monitoring minimal esidual disease in acute myeloid leukemia (AML) and myelodyslastic syndrome (MDS) patients [1]. Besides this, WT1 is being urrently tested for vaccination. Although the oncogenic behaviour f WT1 in leukemia has been proved, the mechanism has not yet een clearly explained. Detailed understanding of the role of WT1 n leukemia will improve the utilization of WT1 in diagnostics, rognostics and also in therapy. WT1 has an enormous number of ariants due to alternative splicing, alternative initiation of transation etc. In 2004, a novel N-terminally truncated WT1 variant sWT1) has been described by Dalloso et al. [2]. The sWT1 arises rom alternative first exon E1a; it lacks the N-terminal transcripional repression domain of full length WT1 (fWT1) and it activates xpression of genes, which are repressed by fWT1. Hossain et al. 3] reported overexpression of sWT1 in leukemias and assumed hat sWT1 might be the oncogenic WT1 variant based on in vitro xperiments. Recently, we have read with high interest a study of shikawa et al. [4] which supplemented Hossain’s and also our own ata on sWT1 expression in myeloid leukemias. In our study, we have tested sWT1 expression in chronic myeloid eukemia (CML) and AML patients. We designed discriminating forard primers hybridizing onto exon E1 or E1a and common probe nd reverse primer hybridizing onto exon 2 to distinguish between WT1 and sWT1: forward sWT1 5′-cctgcctactcctgggct-3′, forward WT1 5′-cagcccgctattcgcaatc-3′, reverse 5′-tcatgcttgaatgagtggttgg′ and probe 5′-FAM cagcacggtcaccttcgacggga BHQ1-3′. We used DNAs from K562, CML-T1 and JURL-MK1 cell lines as positive ontrols. All three cell lines expressed low levels of sWT1 (less han normalized 100 copies) and high levels of fWT1 (more than 0,000 normalized copies). The cDNAs from total leukocytes of four ormal individuals were used as negative controls; WT1 expresion was negligible. Plasmid standards prepared from K562 cell ine were used for checking reaction sensitivity, preparing stanard curves and performing quantification. Expression data were ormalized to glucoronidase (GUS) gene expression [5]. We have nalyzed samples of total leukocytes of peripheral blood (PB) in 48 ML and 18 CML patients. AML samples were collected at the time f diagnosis; different FAB subtypes were included in the study. ix of 18 CML patients’ samples were collected in major moleclar response (MMR, BCR-ABL levels ≤ 0.1%), 6 in hematological elapse (Hr, increase in leukocyte count over the physiological level f 10 × 109/L of peripheral blood) and 6 in accelerated phase (AP;

Unusually Long Survival of a 67-Year-Old Patient with Near-Tetraploid Acute Myeloid Leukemia M0 without Erythroblastic and Megakaryocytic Dysplasia

Patients with near-tetraploid acute myeloid leukemia (NT-AML) typically have poor survival. We present the case of a 67-year-old Caucasian male with NT-AML M0 who had an unusually long first complete remission of 51 months and an overall survival of 80 months. The only characteristic distinguishing him from other previously described patients with NT-AML was the absence of erythroblastic and/or megakaryocytic dysplasia (EMD) at diagnosis. Molecular-genetic testing for AML fusion transcripts associated with a favorable prognosis (PML/RARα,AML1/ETO, and CBFβ/MYH11) were negative, as were other prognostic markers like MLL-PTD,FLT3-ITD, or mutations of FLT3-D835,NPM1, or CEBPA. Expression studies of ERG,MN1, and EVI1 revealed overexpression of ERG only. The absence of EMD may be a useful prognostic/diagnostic feature of this new rare subtype of NT-AML.