Johannes van de Nes

Genetic and clinico-pathologic analysis of metastatic uveal melanoma.

Uveal melanoma is the most common malignant tumor of the adult eye. Fifty percent of tumors will eventually metastasize, and there are no effective treatments for them. Recent studies of uveal melanoma have identified activating mutations in GNAQ and GNA11, loss-of-function mutations in the tumor suppressor gene BAP1, and recurrent mutations in codon 625 of SF3B1. Previous studies have reported the existence of a higher frequency of GNA11 than GNAQ mutations, frequent BAP1 loss, and rare SF3B1 mutations in metastatic uveal melanoma. We analyzed a cohort of 30 uveal melanoma metastases for the occurrence of GNAQ, GNA11, and SF3B1 mutations, as well as BAP1 loss, and correlated these parameters with clinical and histopathologic features. Most (92%) tumors were composed of cells with an epithelioid or mixed (<100% spindle cells) morphology. Tumor samples composed exclusively of spindle cells were rare (n=2, 8%). Most tumors showed a moderate to marked degree of nuclear pleomorphism (n=24, 96%), and contained hyperchromatic, vesicular nuclei with variably conspicuous nucleoli. GNA11 mutations were considerably more frequent than GNAQ mutations (GNA11, GNAQ, and wild-type in 18 (60%), 6 (20%), and 6 (20%) cases, respectively). SF3B1 mutation was found in 1 of 26 tumors (4%), whereas loss of BAP1 expression was present in 13 of 16 tumors (81%). Patients with GNA11-mutant tumors had poorer disease-specific survival (60.0 vs 121.4 months, P=0.03) and overall survival (50.6 vs 121.4 months, P=0.03) than those with tumors lacking GNA11 mutations. The survival data, combined with the predominance of GNA11 mutations in metastases, raises the possibility that GNA11-mutant tumors may be associated with a higher risk of metastasis and poorer prognosis than GNAQ-mutant tumors. Further studies of uveal melanoma are required to investigate the functional and prognostic relevance of oncogenic mutations in GNA11 and GNAQ.

MET overexpressing chordomas frequently exhibit polysomy of chromosome 7 but no MET activation through sarcoma-specific gene fusions

Overexpression of MET and polysomy 7 was formerly demonstrated in chordomas. We investigated mesenchymal-epithelial transition factor (MET) protein expression and copy numbers of chromosome 7 in human chordomas. Furthermore, tumors were screened for gene fusions (PAX3-FKHR, ASPL-TFE3, and SYT-SSX) previously shown to be associated with MET activation in sarcomas. Tissue microarrays (TMAs) were constructed from 66 chordoma samples. MET protein expression was assessed by immunohistochemistry using an immunoreactive score (IRS, scores 0–12). fluorescence in situ hybridization (FISH) with a dual-color DNA probe (7q31) for MET amplification was performed on TMA sections and RT-PCR for PAX3-FKHR, ASPL-TFE3 (type 1 + 2), and SYT-SSX (type 1 + 2) gene fusions on punch biopsies. All tumors (n = 66) expressed MET protein. FISH analysis of 33 tumors lacked MET gene amplification but showed polysomy of chromosome 7 in 15 (45.5%) tumors (13 low and two high polysomies). Although, polysomy 7 showed an increasing incidence with escalating MET IRS, this finding was not statistically significant. PAX3-FKHR, ASPL-TFE3, or SYT-SSX gene fusions were not demonstrable (n = 52). We found MET protein expression in all chordomas. A clear influence of polysomy 7 on MET protein expression could not be statistically demonstrated for this cohort. Moreover, gene fusions with the ability to cause MET overexpression do not occur in chordomas.

Proliferation Activity Is Significantly Elevated in Partially Embolized Cerebral Arteriovenous Malformations

Background: The natural history of cerebral arteriovenous malformations (AVMs) is yet to be determined. It has been shown that angiogenic factors are involved in the pathogenesis of AVMs, in particular in partially embolized lesions. This study was conducted to investigate the expression of angiogenic and proliferative factors in relation to different clinical conditions and treatment modalities. Methods: Immunohistochemistry was performed for 145 consecutive cases of cerebral AVMs. The specimens were stained with antibodies against VEGF, bFGF, Ki 67, CD 34 and CD 31. Expression was correlated with clinical presentation (haemorrhage, seizures or other symptoms), AVM localization, size, eloquence and venous drainage, as well as with preoperative AVM embolization. Results: Whereas no correlation was found between the expression of angiogenic factors and different clinical conditions, we observed a significantly increased proliferation activity as shown by Ki 67 expression in patients with intracerebral haemorrhage (p = 0.02) and in patients with preoperative embolization (p = 0.02). Conclusions: Increased proliferation activity in partially embolized AVMs supports a ‘no-touch’ strategy and clinical observation in high-risk AVMs and demands complete AVM elimination in treatable lesions.

Absence of TERT promoter mutations in primary melanocytic tumours of the central nervous system.

Telomerase reverse transcriptase (TERT) encodes the catalytic subunit of telomerase, which adds telomere repeats to chromosome ends, enabling repeated rounds of cell replication without cells becoming genetically instable and apoptotic or senescent [1–3]. Recent studies uncovered C > T mutations at Chr.5.1295228 and Chr.5.1295250, further referred to as C228 and C250, respectively, in the TERT promoter region in different human cancers, including hepatocellular carcinomas, thyroid cancer, bladder cancer, gliomas and skin melanomas [1–3]. These mutations appear to increase TERT transcriptional activity, by creating ETS transcription factor binding sites. Killela et al. proposed that TERT promoter mutations may be more common in cancers derived from terminally differentiated cells with low self-renewing capacity, whereas rapidly renewing tissues have alternative mechanisms to maintain telomerase lengthening [3]. The incidence of TERT mutations in skin melanoma and melanoma cell lines appears to be very high, up to 70% of the cases examined, and seems to exceed the cumulative frequency of BRAF and NRAS mutations. However, it is still to be determined whether TERT mutations can occur in other melanoma variants. While a recent study showed the absence of TERT promoter mutations in ocular melanomas, no information regarding its mutational status in primary melanocytic tumours of the central nervous system is available [4]. Primary melanocytic tumours occurring in the central nervous system (CNS) are rare neoplasms [5,6]. Histologically, they represent a spectrum of lesions ranging from welldifferentiated melanocytomas to malignant melanomas [5,6]. They are believed to derive from melanocytes normally present in the leptomeninges and share molecular and histological features with uveal melanomas. FFPE tissues corresponding to 25 primary and 3 relapsing primary melanocytic tumours of the CNS (8 melanocytomas, 18 melanocytomas of intermediate grade and 2 melanomas respectively) arising in 25 patients (13 male and 12 female; age range 20–77; mean age 53.7 years), 2 melanotic schwannomas and 23 brain metastases of systemic, non-CNS melanomas (13 male and 10 female; mean age: 58,08; age range 37–78) were retrieved from the Institute of Neuropathology, University of Bonn, Germany, from the DGNN German Brain Tumor Reference Center, Bonn, Germany, from the Institute of Neuropathology, University Duisburg-Essen, Germany, from the Department of Pathology, Catholic University, Rome, Italy, and from the Department of Neuropathology, Royal Prince Alfred Hospital, Sydney, Australia. All tumours were classified according the 2007 WHO classification of CNS tumours [5]. Moreover, 10 uveal melanoma FFPE tissues (5 male, 5 female; age range 29–84, years; mean age 55,4 years) were provided from the Institute of Pathology, University of Messina, Italy and from the Section of Anatomic Pathology, University of Catania, Italy. The study was performed in accordance with the guidelines of the ethical policies of the involved institutions. In particular, the specimens from the Royal Prince Alfred Hospital (RPAH) were collected under an RPAH Human Research Ethics Committee approval. After assignment of the required information to the samples, these have been anonymized. For mutation analysis of the TERT promoter hotspots (C228 and C250) we developed a pyrosequencing assay (Figure 1). The DNA from FFPE tumour tissue was extracted using the QIAamp DNA Mini Tissue Kit (Qiagen, Düsseldorf, Germany) according to the manufacturer’s instructions. A 169 bp fragment of the 5′ region of TERT containing the C228 and C250 coding region was amplified using the primers TERT fwd 5′-CCTGCCCCTTCACCTTCCAG-3′ and TERT rev 5′-biotinAGGACGCAGCGCTGCCTGAA-3′ using 50 ng genomic DNA as template. For pyrosequencing the primer TERT Py-5′-ACCCCGCCCCGTCCCGACCCC-3′ was used with the nucleotide dispensation order GTCGTCCGCATGCCTC to sequence TT/CCCGGGTCCCCGGCCCAGCCCCT/CTCCG. Ten glioblastomas harbouring TERT promoter (C228 or C250) mutations have been used as positive controls (Figure 1); The GNAQ, GNA11 (hotspot codon 209) and NRAS (exons 2 and 3) have been analysed for the presence of mutations as previously described [7]. None of the primary melanocytic tumours of the CNS (0/25) showed TERT promoter mutations at position

SF3B1 and BAP1 mutations in blue nevus-like melanoma

Blue nevi are melanocytic tumors originating in the cutaneous dermis. Malignant tumors may arise in association with or resembling blue nevi, so called ‘blue nevus-like melanoma’, which can metastasize and result in patient death. Identifying which tumors will behave in a clinically aggressive manner can be challenging. Identifying genetic alterations in such tumors may assist in their diagnosis and prognostication. Blue nevi are known to be genetically related to uveal melanomas (eg, both harboring GNAQ and GNA11 mutations). In this study, we analyzed a large cohort (n=301) of various morphologic variants of blue nevi and related tumors including tumors diagnosed as atypical blue nevi (n=21), and blue nevus-like melanoma (n=12), screening for all gene mutations known to occur in uveal melanoma. Similar to published reports, we found the majority of blue nevi harbored activating mutations in GNAQ (53%) or GNA11 (15%). In addition, rare CYSLTR2 (1%) and PLCB4 (1%) mutations were identified. EIF1AX, SF3B1, and BAP1 mutations were also detected, with BAP1 and SF3B1 R625 mutations being present only in clearly malignant tumors (17% (n=2) and 25% (n=3) of blue nevus-like melanoma, respectively). In sequencing data from a larger cohort of cutaneous melanomas, this genetic profile was also identified in tumors not originally diagnosed as blue nevus-like melanoma. Our findings suggest that the genetic profile of coexistent GNAQ or GNA11 mutations with BAP1 or SF3B1 mutations can aid the histopathological diagnosis of blue nevus-like melanoma and distinguish blue nevus-like melanoma from conventional epidermal-derived melanomas. Future studies will need to further elucidate the prognostic implications and appropriate clinical management for patients with tumors harboring these mutation profiles.

Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi

Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n=61), followed by less frequent mutations in GNA11 (16%, n=17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T>A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi.

Immunocytochemical analysis of glucose transporter protein‐1 (GLUT‐1) in typical, brain invasive, atypical and anaplastic meningioma

Glucose transporter‐1 (GLUT‐1) is one of the major isoforms of the family of glucose transporter proteins that facilitates the import of glucose in human cells to fuel anaerobic metabolism. The present study was meant to determine the extent of the anaerobic/hypoxic state of the intratumoral microenvironment by staining for GLUT‐1 in intracranial non‐embolized typical (WHO grade I; n = 40), brain invasive and atypical (each WHO grade II; n = 38) and anaplastic meningiomas (WHO grade III, n = 6). In addition, GLUT‐1 staining levels were compared with the various histological criteria used for diagnosing WHO grade II and III meningiomas, namely, brain invasion, increased mitotic activity and atypical cytoarchitectural change, defined by the presence of at least three out of hypercellularity, sheet‐like growth, prominent nucleoli, small cell change and “spontaneous” necrosis. The level of tumor hypoxia was assessed by converting the extent and intensity of the stainings by multiplication in an immunoreactive score (IRS) and statistically evaluated. The results were as follows. (1) While GLUT‐1 expression was found to be mainly weak in WHO grade I meningiomas (IRS = 1–4) and to be consistently strong in WHO grade III meningiomas (IRS = 6–12), in WHO grade II meningiomas GLUT‐1 expression was variable (IRS = 1–9). (2) Histologically typical, but brain invasive meningiomas (WHO grade II) showed no or similarly low levels of GLUT‐1 expression as observed in WHO grade I meningiomas (IRS = 0–4). (3) GLUT‐1 expression was observed in the form of a patchy, multifocal staining reaction in 76% of stained WHO grade I‐III meningiomas, while diffuse staining (in 11%) and combined multifocal and areas of diffuse staining (in 13%) were only detected in WHO grades II and III meningiomas, except for uniform staining in angiomatous WHO grade I meningioma. (4) “Spontaneous” necrosis and small cell change typically occurred away from the intratumoral capillary network embedded within the pattern of GLUT‐1 staining. Taken together, GLUT‐1 staining cannot be applied as a substitute for histologic grading in order to predict tumor behavior. However, assessment of tumor hypoxia in association with “spontaneous” necrosis and foci of small cell change may substantially contribute to the neuropathologic diagnosis of WHO grades II and III meningioma.

Frequent GNAQ, GNA11, and EIF1AX Mutations in Iris Melanoma

Purpose The most common malignant intraocular tumors with a high mortality in adults are uveal melanomas. Uveal melanomas arise most frequently in the choroid or ciliary body (97%) and rarely in the iris (3%). Whereas conjunctival and posterior uveal (ciliary body and choroidal) melanomas have been studied in more detail genetically, little data exist regarding iris melanomas. Methods In our study, we genetically analyzed 19 iris melanomas, 8 ciliary body melanomas, 3 ring melanomas, and 4 iris nevi. A targeted next-generation sequencing approach was applied, covering the mutational hotspot regions of nine genes known to be mutated in conjunctival and uveal melanoma (BRAF, NRAS, KIT, GNAQ, GNA11, CYSLTR2, SF3B1, EIF1AX, and BAP1). Results Activating GNAQ or GNA11 hotspot mutations were detected in a mutually exclusive fashion in 84% (16/19) of iris melanomas. EIF1AX gene mutations also were frequent, detected in 42% (8/19) of iris melanomas. In 4 iris nevi, one GNAQ mutation was identified. GNAQ, GNA11, EIF1AX, and BAP1 mutations were identified at varying frequencies in ciliary body and ring melanomas. Conclusions In this most comprehensive genetic analysis of iris melanomas published to date, we find iris melanomas to be related genetically to choroidal and ciliary body melanomas, frequently harboring GNAQ, GNA11, and EIF1AX mutations. Future studies will need to assess if screening mutation profiles in iris melanomas may be of diagnostic or prognostic value.

Surgical treatment of primary intracranial myxoma in a child following radiotherapy: case report and review of the literature

IntroductionMyxomas are benign tumors of the mesenchymal origin and account for about half of the benign cardiac tumors. Occasionally, they occur at other locations, but the intracranial manifestation of a myxoma is exceptionally rare. As a secondary neoplasia following radiotherapy, myxoma has only been reported once in the literature.Material and methodsA 12-year-old girl, who was previously treated for a medulloblastoma, was diagnosed with a new lesion at the left transverse sinus in the follow-up magnetic resonance imaging (MRI). Indication for surgery was made and complete removal could be achieved.Results and discussionHistological examination revealed a myxoma. Further staging showed no other manifestation of the myxoma. The close relation to the radiation field of the posterior fossa makes it highly suggestive that the myxoma developed as a secondary neoplasia induced by radiotherapy. Treatment philosophy for this benign tumor entity is a completed resection of the lesion with regular follow-up MRI.

Intraventricular melanocytoma diagnosis confirmed by gene mutation profile: Intraventricular melanocytoma diagnosis

Primary leptomeningeal melanocytic tumors (PLMTs) are rare. They usually arise along the spinal cord and at the skull base. Here we report on a patient with a very rare intraventricular melanocytoma. Histologically, a melanocytic tumor was clearly diagnosed. However, to make the uncommon diagnosis of an intraventricular melanocytoma, metastatic melanoma needed to be excluded. Next generation sequencing covering gene mutations that may occur in PLMTs and cutaneous melanoma was performed. The unique gene mutation profile detected, consisting of an activating CYSLTR2 L129Q mutation and EIF1AX G9R mutation and a lack of mutations in genes known to occur in metastatic melanoma (i.e. BRAF or NRAS) confirmed the diagnosis of an intraventricular melanocytoma. This case report is the second intraventricular melanocytoma published to date and demonstrates the value of applying novel genetic assays to make this diagnosis.