Julie Sheldon
Spanish National Research Council
Network
Latest external collaboration on country level. Dive into details by clicking on the dots.
Publication
Featured researches published by Julie Sheldon.
Microbiology and Molecular Biology Reviews | 2012
Esteban Domingo; Julie Sheldon; Celia Perales
SUMMARY Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory.
Journal of Clinical Microbiology | 2015
Josep Quer; J. Gregori; Francisco Rodríguez-Frias; Maria Buti; Antonio Madejón; Sofía Pérez-del-Pulgar; Damir Garcia-Cehic; Rosario Casillas; Maria Blasi; M. Homs; David Tabernero; Miguel Alvarez-Tejado; Jose Manuel Muñoz; Maria Cubero; Andrea Caballero; Jose Antonio delCampo; Esteban Domingo; Irene Belmonte; Leonardo Nieto; Sabela Lens; Paloma Muñoz-de-Rueda; Paloma Sanz-Cameno; S. Sauleda; Marta Bes; Jordi Gómez; Carlos Briones; Celia Perales; Julie Sheldon; Lluis Castells; L Viladomiu
ABSTRACT Hepatitis C virus (HCV) is classified into seven major genotypes and 67 subtypes. Recent studies have shown that in HCV genotype 1-infected patients, response rates to regimens containing direct-acting antivirals (DAAs) are subtype dependent. Currently available genotyping methods have limited subtyping accuracy. We have evaluated the performance of a deep-sequencing-based HCV subtyping assay, developed for the 454/GS-Junior platform, in comparison with those of two commercial assays (Versant HCV genotype 2.0 and Abbott Real-time HCV Genotype II) and using direct NS5B sequencing as a gold standard (direct sequencing), in 114 clinical specimens previously tested by first-generation hybridization assay (82 genotype 1 and 32 with uninterpretable results). Phylogenetic analysis of deep-sequencing reads matched subtype 1 calling by population Sanger sequencing (69% 1b, 31% 1a) in 81 specimens and identified a mixed-subtype infection (1b/3a/1a) in one sample. Similarly, among the 32 previously indeterminate specimens, identical genotype and subtype results were obtained by direct and deep sequencing in all but four samples with dual infection. In contrast, both Versant HCV Genotype 2.0 and Abbott Real-time HCV Genotype II failed subtype 1 calling in 13 (16%) samples each and were unable to identify the HCV genotype and/or subtype in more than half of the non-genotype 1 samples. We concluded that deep sequencing is more efficient for HCV subtyping than currently available methods and allows qualitative identification of mixed infections and may be more helpful with respect to informing treatment strategies with new DAA-containing regimens across all HCV subtypes.
Journal of Virology | 2013
Celia Perales; Nathan M. Beach; Isabel Gallego; María Eugenia Soria; Josep Quer; Juan Ignacio Esteban; Charles M. Rice; Esteban Domingo; Julie Sheldon
ABSTRACT Cell culture-produced hepatitis C virus (HCV) has been subjected to up to 100 serial passages in human hepatoma cells in the absence or presence of different doses of alpha interferon (IFN-α). Virus survival, genetic changes, fitness levels, and phenotypic traits have been examined. While high initial IFN-α doses (increasing from 1 to 4 IU/ml) did not allow HCV survival beyond passage 40, a gradual exposure (from 0.25 to 10 IU/ml) allowed the virus to survive for at least 100 passages. The virus passaged in the presence of IFN-α acquired IFN-α resistance as evidenced by enhanced progeny production and viral protein expression in an IFN-α environment. A partial IFN-α resistance was also noted in populations passaged in the absence of IFN-α. All lineages acquired adaptative mutations, and multiple, nonsynonymous mutations scattered throughout the genome were present in IFN-α-selected populations. Comparison of consensus sequences indicates a dominance of synonymous versus nonsynonymous substitutions. IFN-α-resistant populations displayed decreased sensitivity to a combination of IFN-α and ribavirin. A phenotypic trait common to all assayed viral populations is the ability to increase shutoff host cell protein synthesis, accentuated in infections with IFN-α-selected populations carried out in the presence of IFN-α. The trait was associated with enhanced phosphorylation of protein kinase R (PKR) and eIF2α, although other contributing factors are likely. The results suggest that multiple, independent mutational pathways can confer IFN-α resistance to HCV and might explain why no unified picture has been obtained regarding IFN-α resistance in vivo.
PLOS ONE | 2013
Ana Maria Ortega-Prieto; Julie Sheldon; Ana Grande-Pérez; Héctor Tejero; Josep Gregori; Josep Quer; Juan Ignacio Esteban; Esteban Domingo; Celia Perales
Lethal mutagenesis, or virus extinction produced by enhanced mutation rates, is under investigation as an antiviral strategy that aims at counteracting the adaptive capacity of viral quasispecies, and avoiding selection of antiviral-escape mutants. To explore lethal mutagenesis of hepatitis C virus (HCV), it is important to establish whether ribavirin, the purine nucleoside analogue used in anti-HCV therapy, acts as a mutagenic agent during virus replication in cell culture. Here we report the effect of ribavirin during serial passages of HCV in human hepatoma Huh-7.5 cells, regarding viral progeny production and complexity of mutant spectra. Ribavirin produced an increase of mutant spectrum complexity and of the transition types associated with ribavirin mutagenesis, resulting in HCV extinction. Ribavirin-mediated depletion of intracellular GTP was not the major contributory factor to mutagenesis since mycophenolic acid evoked a similar decrease in GTP without an increase in mutant spectrum complexity. The intracellular concentration of the other nucleoside-triphosphates was elevated as a result of ribavirin treatment. Mycophenolic acid extinguished HCV without an intervening mutagenic activity. Ribavirin-mediated, but not mycophenolic acid-mediated, extinction of HCV occurred via a decrease of specific infectivity, a feature typical of lethal mutagenesis. We discuss some possibilities to explain disparate results on ribavirin mutagenesis of HCV.
Viruses | 2015
Alexander W. Tarr; Tanvi Khera; Kathrin Hueging; Julie Sheldon; Eike Steinmann; Thomas Pietschmann; Richard J. P. Brown
In the 26 years since the discovery of Hepatitis C virus (HCV) a major global research effort has illuminated many aspects of the viral life cycle, facilitating the development of targeted antivirals. Recently, effective direct-acting antiviral (DAA) regimens with >90% cure rates have become available for treatment of chronic HCV infection in developed nations, representing a significant advance towards global eradication. However, the high cost of these treatments results in highly restricted access in developing nations, where the disease burden is greatest. Additionally, the largely asymptomatic nature of infection facilitates continued transmission in at risk groups and resource constrained settings due to limited surveillance. Consequently a prophylactic vaccine is much needed. The HCV envelope glycoproteins E1 and E2 are located on the surface of viral lipid envelope, facilitate viral entry and are the targets for host immunity, in addition to other functions. Unfortunately, the extreme global genetic and antigenic diversity exhibited by the HCV glycoproteins represents a significant obstacle to vaccine development. Here we review current knowledge of HCV envelope protein structure, integrating knowledge of genetic, antigenic and functional diversity to inform rational immunogen design.
Journal of Virology | 2014
Julie Sheldon; Nathan M. Beach; Elena Moreno; Isabel Gallego; David Piñeiro; Encarnación Martínez-Salas; Josep Gregori; Josep Quer; Juan Ignacio Esteban; Charles M. Rice; Esteban Domingo; Celia Perales
ABSTRACT Passage of hepatitis C virus (HCV) in human hepatoma cells resulted in populations that displayed partial resistance to alpha interferon (IFN-α), telaprevir, daclatasvir, cyclosporine, and ribavirin, despite no prior exposure to these drugs. Mutant spectrum analyses and kinetics of virus production in the absence and presence of drugs indicate that resistance is not due to the presence of drug resistance mutations in the mutant spectrum of the initial or passaged populations but to increased replicative fitness acquired during passage. Fitness increases did not alter host factors that lead to shutoff of general host cell protein synthesis and preferential translation of HCV RNA. The results imply that viral replicative fitness is a mechanism of multidrug resistance in HCV. IMPORTANCE Viral drug resistance is usually attributed to the presence of amino acid substitutions in the protein targeted by the drug. In the present study with HCV, we show that high viral replicative fitness can confer a general drug resistance phenotype to the virus. The results exclude the possibility that genomes with drug resistance mutations are responsible for the observed phenotype. The fact that replicative fitness can be a determinant of multidrug resistance may explain why the virus is less sensitive to drug treatments in prolonged chronic HCV infections that favor increases in replicative fitness.
Current Opinion in Virology | 2014
Celia Perales; Nathan M. Beach; Julie Sheldon; Esteban Domingo
Resistance to interferon (IFN) in hepatitis C virus (HCV) differs from resistance to standard, directly-acting antiviral (DAA) agents in that the virus confronts a multicomponent antiviral state evoked by IFN. This renders unlikely the repeated selection of the same specific mutations that confer an IFN-resistance phenotype. Comparison of amino acid sequences of viral proteins in HCV that replicates in the presence of IFN in vivo or in cell culture (with entire virus or subgenomic replicons) reveals very few common candidate IFN resistance substitutions. Multiple host and viral factors contribute to divergent responses to IFN. The environmental heterogeneity in which exogenous IFN is expected to exert its selective effect may increase as a result of incorporation of new DAAs in therapy.
Antimicrobial Agents and Chemotherapy | 2016
Isabel Gallego; Julie Sheldon; Elena Moreno; Josep Gregori; Josep Quer; Juan Ignacio Esteban; Charles M. Rice; Esteban Domingo; Celia Perales
ABSTRACT Sofosbuvir displays a high phenotypic barrier to resistance, and it is a component of several combination therapies for hepatitis C virus (HCV) infections. HCV fitness can be a determinant of decreased sensitivity to direct-acting antiviral agents such as telaprevir or daclatasvir, but fitness-dependent decreased drug sensitivity has not been established for drugs with a high phenotypic barrier to resistance. Low- and high-fitness HCV populations and biological clones derived from them were used to infect Huh-7.5 hepatoma cells. Sofosbuvir efficacy was analyzed by measuring virus progeny production during several passages and by selection of possible sofosbuvir resistance mutations determined by sequencing the NS5B-coding region of the resulting populations. Sofosbuvir exhibited reduced efficacy against high-fitness HCV populations, without the acquisition of sofosbuvir-specific resistance mutations. A reduced sofosbuvir efficacy, similar to that observed with the parental populations, was seen for high-fitness individual biological clones. In independently derived high-fitness HCV populations or clones passaged in the presence of sofosbuvir, M289L was selected as the only substitution in the viral polymerase NS5B. In no case was the sofosbuvir-specific resistance substitution S282T observed. High HCV fitness can lead to decreased sensitivity to sofosbuvir, without the acquisition of specific sofosbuvir resistance mutations. Thus, fitness-dependent drug sensitivity can operate with HCV inhibitors that display a high barrier to resistance. This mechanism may underlie treatment failures not associated with selection of sofosbuvir-specific resistance mutations, linked to in vivo fitness of pretreatment viral populations.
Virus Research | 2015
Mónica R. García-Risco; Erika Vázquez; Julie Sheldon; Eike Steinmann; Nina Riebesehl; Tiziana Fornari; Guillermo Reglero
Previous studies using lipid extracts of heather (Calluna vulgaris) leaves showed the presence of high concentrations of ursolic and oleanolic acid. These two compounds have been reported to present antiviral activity against hepatitis C virus (HCV). In this work, the supercritical fluid extraction of heather was studied with the aim of assessing a potential anti-HCV activity of the extracts owing to their triterpenic acid content. Supercritical extraction assays were carried out exploring the pressure range of 20-50 MPa, temperatures of 40-70°C and 0-15% of ethanol cosolvent. The content of oleanolic and ursolic acid in the extracts were determined, and different samples were screened for cellular cytotoxicity and virus inhibition using a HCV cell culture infection system. Antiviral activity was observed in most extracts. In general, superior anti-HCV activity was observed for higher contents of oleanolic and ursolic acids in the extracts.
Journal of Clinical Microbiology | 2016
Josep Quer; J. Gregori; Francisco Rodríguez-Frias; Maria Buti; Antonio Madejón; Sofía Pérez-del-Pulgar; Damir Garcia-Cehic; Rosario Casillas; Maria Blasi; M. Homs; David Tabernero; Miguel Alvarez-Tejado; Jose Manuel Muñoz; Maria Cubero; Andrea Caballero; Jose Antonio delCampo; Esteban Domingo; Irene Belmonte; Leonardo Nieto; Sabela Lens; Paloma Muñoz-de-Rueda; Paloma Sanz-Cameno; S. Sauleda; Marta Bes; Jordi Gómez; Carlos Briones; Celia Perales; Julie Sheldon; Lluis Castells; L Viladomiu
Volume 53, no. 1, p. [219–226][1], 2015. Page 221, Table 1: The sequence for primer 13N5Bo8254 should read “GTTGTAAAACGACGGCCAGT CNTAYGAYACCMGNTGYTTTGACTC .” [1]: /lookup/doi/10.1128/JCM.02093-14