Katerina Kourentzi

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF165) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant kon = 4.79 ± 0.03 × 104 M−1 s−1 and a dissociation rate constant koff = 5.21 ± 0.02 × 10−4 s−1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition.

Unified superresolution experiments and stochastic theory provide mechanistic insight into protein ion-exchange adsorptive separations

Significance Adsorption of proteins underlies the purification of biopharmaceuticals, as well as therapeutic apheresis, immunoassays, and biosensors. In particular, separation of proteins by interactions with charged ligands on surfaces (ion-exchange chromatography) is an essential tool of the modern pharmaceutical industry. By quantifying the interactions of single proteins with individual charged ligands, we demonstrate that clusters of charges are necessary to create functional adsorption sites and that even chemically identical ligands create sites of varying kinetic properties that depend on steric availability at the interface. Chromatographic protein separations, immunoassays, and biosensing all typically involve the adsorption of proteins to surfaces decorated with charged, hydrophobic, or affinity ligands. Despite increasingly widespread use throughout the pharmaceutical industry, mechanistic detail about the interactions of proteins with individual chromatographic adsorbent sites is available only via inference from ensemble measurements such as binding isotherms, calorimetry, and chromatography. In this work, we present the direct superresolution mapping and kinetic characterization of functional sites on ion-exchange ligands based on agarose, a support matrix routinely used in protein chromatography. By quantifying the interactions of single proteins with individual charged ligands, we demonstrate that clusters of charges are necessary to create detectable adsorption sites and that even chemically identical ligands create adsorption sites of varying kinetic properties that depend on steric availability at the interface. Additionally, we relate experimental results to the stochastic theory of chromatography. Simulated elution profiles calculated from the molecular-scale data suggest that, if it were possible to engineer uniform optimal interactions into ion-exchange systems, separation efficiencies could be improved by as much as a factor of five by deliberately exploiting clustered interactions that currently dominate the ion-exchange process only accidentally.

Dynamics of an anti-VEGF DNA aptamer: a single-molecule study.

Single-molecule fluorescence resonance energy transfer (SMFRET) was used to study the interaction of a 25-nucleotide (nt) DNA aptamer with its binding target, vascular endothelial growth factor (VEGF). Conformational dynamics of the aptamer were studied in the absence of VEGF in order to characterize fluctuations in the unbound nucleic acid. SMFRET efficiency distributions showed that, while the aptamer favors a base-paired conformation, there are frequent conversions to higher energy conformations. Conversions to higher energy structures were also demonstrated to be dependent on the concentration of Mg2+-counterion by an overall broadening of the SMFRET efficiency distribution at lower Mg2+ concentration. Introduction of VEGF caused a distinct increase in the frequency of lower SMFRET efficiencies, indicating that favorable interaction of the DNA aptamer with its VEGF target directs aptamer structure towards a more open conformation.

Persistent Luminescence Strontium Aluminate Nanoparticles as Reporters in Lateral Flow Assays

Demand for highly sensitive, robust diagnostics and environmental monitoring methods has led to extensive research in improving reporter technologies. Inorganic phosphorescent materials exhibiting persistent luminescence are commonly found in electroluminescent displays and glowing paints but are not widely used as reporters in diagnostic assays. Persistent luminescence nanoparticles (PLNPs) offer advantages over conventional photoluminescent probes, including the potential for enhanced sensitivity by collecting time-resolved measurements or images with decreased background autofluorescence while eliminating the need for expensive optical hardware, superior resistance to photobleaching, amenability to quantitation, and facile bioconjugation schemes. We isolated rare-earth doped strontium aluminate PLNPs from larger-particle commercial materials by wet milling and differential sedimentation and water-stabilized the particles by silica encapsulation using a modified Stöber process. Surface treatment with aldehyde silane followed by reductive amination with heterobifunctional amine-poly(ethylene glycol)-carboxyl allowed covalent attachment of proteins to the particles using standard carbodiimide chemistry. NeutrAvidin PLNPs were used in lateral flow assays (LFAs) with biotinylated lysozyme as a model analyte in buffer and monoclonal anti-lysozyme HyHEL-5 antibodies at the test line. Preliminary experiments revealed a limit of detection below 100 pg/mL using the NeutrAvidin PLNPs, which was approximately an order of magnitude more sensitive than colloidal gold.

Biophysical characterization of DNA and RNA aptamer interactions with hen egg lysozyme.

This work characterized the binding of an RNA aptamer recognizing hen egg white lysozyme, as well as a literature-reported single-stranded DNA analog of sequence identical to the original RNA aptamer, using fluorescence anisotropy, isothermal titration calorimetry (ITC) and analytical ultracentrifugation. The polyanionic DNA aptamer analog is selective for lysozyme even over cationic cytochrome c and has been reported to be successfully used in biosensing applications. The association however, is predominantly of electrostatic character, strongly salt-sensitive and entropically-driven, in contrast to previously described enthalpically-driven antibody-lysozyme and DNA aptamer-VEGF interactions. With a moderate selectivity for their target, high salt-sensitivity along with fast association and dissociation behavior, these molecules might serve as pseudo-affinity ligands for biomolecular separations.

Association Energetics of Cross-Reactive and Specific Antibodies†

HyHEL-8, HyHEL-10, and HyHEL-26 (HH8, HH10, and HH26, respectively) are murine monoclonal IgG(1) antibodies which share over 90% variable-region amino acid sequence identity and recognize identical structurally characterized epitopes on hen egg white lysozyme (HEL). Previous immunochemical and surface plasmon resonance-based studies have shown that these antibodies differ widely in their tolerance of mutations in the epitope. While HH8 is the most cross-reactive, HH26 is rigidified by a more extensive network of intramolecular salt links and is highly specific, with both association and dissociation rates strongly affected by epitope mutations. HH10 is of intermediate specificity, and epitope mutations produce changes primarily in the dissociation rate. Calorimetric characterization of the association energetics of these three antibodies with the native antigen HEL and with Japanese quail egg white lysozyme (JQL), a naturally occurring avian variant, shows that the energetics of interaction correlate with cross-reactivity and specificity. These results suggest that the greater cross-reactivity of HH8 may be mediated by a combination of conformational flexibility and less specific intermolecular interactions. Thermodynamic calculations suggest that upon association HH8 incurs the largest configurational entropic penalty and also the smallest loss of enthalpic driving force with variant antigen. Much smaller structural perturbations are expected in the formation of the less flexible HH26 complex, and the large loss of enthalpic driving force observed with variant antigen reflects its specificity. The observed thermodynamic parameters correlate well with the observed functional behavior of the antibodies and illustrate fundamental differences in thermodynamic characteristics between cross-reactive and specific molecular recognition.

High ionic strength narrows the population of sites participating in protein ion-exchange adsorption: A single-molecule study

The retention and elution of proteins in ion-exchange chromatography is routinely controlled by adjusting the mobile phase salt concentration. It has repeatedly been observed, as judged from adsorption isotherms, that the apparent heterogeneity of adsorption is lower at more-eluting, higher ionic strength. Here, we present an investigation into the mechanism of this phenomenon using a single-molecule, super-resolution imaging technique called motion-blur Points Accumulation for Imaging in Nanoscale Topography (mbPAINT). We observed that the number of functional adsorption sites was smaller at high ionic strength and that these sites had reduced desorption kinetic heterogeneity, and thus narrower predicted elution profiles, for the anion-exchange adsorption of α-lactalbumin on an agarose-supported, clustered-charge ligand stationary phase. Explanations for the narrowing of the functional population such as inter-protein interactions and protein or support structural changes were investigated through kinetic analysis, circular dichroism spectroscopy, and microscopy of agarose microbeads, respectively. The results suggest the reduction of heterogeneity is due to both electrostatic screening between the protein and ligand and tuning the steric availability within the agarose support. Overall, we have shown that single molecule spectroscopy can aid in understanding the influence of ionic strength on the population of functional adsorbent sites participating in the ion-exchange chromatographic separation of proteins.

Engineered 5S ribosomal RNAs displaying aptamers recognizing vascular endothelial growth factor and malachite green

In previous work, Vibrio proteolyticus 5S rRNA was shown to stabilize 13–50 nucleotide “guest” RNA sequences for expression in Escherichia coli. The expressed chimeric RNAs accumulated to high levels in E. coli without being incorporated into ribosomes and without obvious effects on the host cells. In this work, we inserted sequences encoding known aptamers recognizing a protein and an organic dye into the 5S rRNA carrier and showed that aptamer function is preserved in the chimeras. A surface plasmon resonance competitive binding assay demonstrated that a vascular endothelial growth factor (VEGF) aptamer/5S rRNA chimera produced in vitro by transcriptional runoff could compete with a DNA aptamer for VEGF, implying binding of the growth factor by the VEGF “ribosomal RNA aptamer.” Separately, a 5S rRNA chimera displaying an aptamer known to increase the fluorescence of malachite green (MG) also enhanced MG fluorescence. Closely related control rRNA molecules showed neither activity. The MG aptamer/5S rRNA chimera, like the original MG aptamer, also increased the fluorescence of other triphenyl methane (TPM) dyes such as crystal violet, methyl violet, and brilliant green, although less effectively than with MG. These results indicate that the molecular recognition properties of aptamers are not lost when they are expressed in the context of a stable 5S rRNA carrier. Inclusion of the aptamer in a carrier may facilitate production of large quantities of RNA aptamers, and may open an approach to screening aptamer libraries in vivo. Copyright

Functionalized viral nanoparticles as ultrasensitive reporters in lateral-flow assays

Two types of viral nanoparticles were functionalized with target-specific antibodies and multiple copies of an enzymatic reporter (horseradish peroxidase). The particles were successfully integrated into an immunochromatographic assay detecting MS2 bacteriophage, a model for viral pathogens. The sensitivity of the assay was greatly superior to conventional gold nanoparticle lateral flow assays, and results could easily be evaluated, even without advanced lab instruments.

Microbial identification by immunohybridization assay of artificial RNA labels.

Ribosomal RNA (rRNA) and engineered stable artificial RNAs (aRNAs) are frequently used to monitor bacteria in complex ecosystems. In this work, we describe a solid-phase immunocapture hybridization assay that can be used with low molecular weight RNA targets. A biotinylated DNA probe is efficiently hybridized in solution with the target RNA, and the DNA-RNA hybrids are captured on streptavidin-coated plates and quantified using a DNA-RNA heteroduplex-specific antibody conjugated to alkaline phosphatase. The assay was shown to be specific for both 5S rRNA and low molecular weight (LMW) artificial RNAs and highly sensitive, allowing detection of as little as 5.2 ng (0.15 pmol) in the case of 5S rRNA. Target RNAs were readily detected even in the presence of excess nontarget RNA. Detection using DNA probes as small as 17 bases targeting a repetitive artificial RNA sequence in an engineered RNA was more efficient than the detection of a unique sequence.