Keiichi Saeki

Prions prevent neuronal cell-line death

Prion diseases, such as scrapie and bovine spongiform encephalopathy (BSE) in animals and Creutzfeldt-Jakob disease (CJD) in humans, are neurodegenerative conditions characterized by the accumulation of a post-transcriptionally modified, pathological form of a host-encoded glycoprotein, designated PrPSc. The physiological function of the normal cellular isoform, PrPC, is unknown, although studies of mice devoid of PrPC have indicated that it may be involved in normal synaptic function and survival of Purkinje cells, but findings have been inconsistent. We find that serum removal from the cell culture causes apoptosis in Prnp −/− cells (in which a disrupted form of the prion protein is produced) but not in Prnp +/+ (wild-type) cells. Transduction of PrP or the Bcl-2 gene suppressed apoptosis of Prnp −/− cells under serum-free conditions. We also found that Prnp −/− cells extended shorter neurites than Prnp +/+ cells, but expression of PrPC increased their length. These findings support the idea that the loss of function of PrPC may partly underlie the pathogenesis of prion diseases.

Impairment of superoxide dismutase activation by N-terminally truncated prion protein (PrP) in PrP-deficient neuronal cell line.

Previous studies have reported a neuroprotective role for cellular prion protein (PrP(C)) against apoptosis induced by serum deprivation in an immortalized prion protein gene (Prnp)-deficient neuronal cell line, but the mechanisms remain unclear. In this study, to investigate the mechanisms by which PrP(C) prevents apoptosis, the authors compared apoptosis of Prnp(-/-) cells with that of Prnp(-/-) cells expressing the wild-type PrP(C) or PrP(C) lacking N-terminal octapeptide repeat region under serum-free conditions. Re-introduction of Prnp rescued cells from apoptosis, upregulated superoxide dismutase (SOD) activity, enhanced superoxide anion elimination, and inhibited caspase-3/9 activation. On the other hand, N-terminally truncated PrP(C) enhanced apoptosis accompanied by potentiation of superoxide production and caspase-3/9 activation due to inhibition of SOD. These results suggest that PrP(C) protects Prnp(-/-) cells from apoptosis via superoxide- and caspase-3/9-dependent pathways by upregulating SOD activity. Furthermore, the octapeptide repeat region of PrP(C) plays an essential role in regulating apoptosis and SOD activity.

Recent advances in clarifying prion protein functions using knockout mice and derived cell lines.

Considerable information on the functions of prion protein (PrP) has been accumulated. One experimental approach is the use of PrP gene-knockout mice and derived cell lines. This approach has contributed to elucidating the functions of cellular prion protein (PrP(C)), such as its anti-oxidative and anti-apoptotic roles. This review will introduce the recent advances in prion biology made possible by the availability of these tools.

Analysis of PrPc mRNA by in situ Hybridization in Brain, Placenta, Uterus and Testis of Rats

An amyloid-like isoform of a 33- to 34-kD glycoprotein, termed as the scrapie prion protein (PrPsc), plays a critical role in transmissible spongiform encephalopathies of animals and humans. It has even been suggested to present the responsible infectious agent. This protein is a posttranslationally modified form of the cellular isoform of prion protein (PrPc). Hitherto, little has been known about the functions of PrPc. In order to examine the localization of PrPc mRNA in rat tissues, the in situ hybridization technique was performed. In rat brain, PrPc mRNA was predominantly localized within pyramidal cells of the hippocampus, large neurons of the thalamus and neocortex, and Purkinje cells of the cerebellum. In the placenta, not only PrPc mRNA was localized to a subpopulation of decidual cells at the highest levels, it was also expressed in the amnion and mesodermal layer of the yolk sac. Furthermore, PrPc mRNA was also expressed in the myometrium of the uterus and seminiferous tubule in the testis. However, signals were not obtained in the lung, spleen, liver of prenatals and other fetus tissues. The distribution of rat PrPc mRNA portrayed the levels which were different among the various types of cells, suggesting that its expression may be regulated in a tissue-specific manner.

Hyperbaric oxygen enhances the expression of prion protein and heat shock protein 70 in a mouse neuroblastoma cell line

Abstract1. Cellular prion protein, PrPC, is a ubiquitous glycoprotein strongly expressed in neurons with an as yet unknown biological function. In previous studies, we demonstrated that PrPC could be regulated by heat shock stress, implying that it might be a stress-responsive protein. Hyperbaric oxygen (HBO) administration is a well-defined model for the study of oxidative stress.2. This study investigated the effect of HBO on PrPC and Hsp 70 expression in mouse neuroblastoma cell lines (N18), assessing the expression of PrPC and Hsp 70 using RT-PCR and Western blotting. HBO administration resulted in a time- and dose-dependent increase in PrPC and Hsp70 expression in N18 cells at both mRNA and protein levels, with a concomitant upregulation of c-Jun N-terminal kinase (JNK).3. Under HBO treatment, luciferase reporter constructs of the rat PrPC promoter, containing the heat shock element (HSE) also present in Hsp70, expressed higher luciferase activity (3- to 10-fold) than those constructs without HSE.4. In summary, these data suggest that PrPC and Hsp 70 may be regulated by HBO, through the activation of JNK. Thus, the activated heat shock transcriptional factor 1, phosphorylated by JNK interacted with HSE in the promoter of PrPC resulted in increased gene expression. These findings are vital for future therapeutic approaches in transmissible spongiform encephalopathies and the understanding of the function of the PrPC.

Molecular modulation of expression of prion protein by heat shock

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPC to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of −680 bp (HSE1; GGAACTATTCTTGACATTGCT), and −1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Fusion of doppel to octapeptide repeat and n-terminal half of hydrophobic region of prion protein confers resistance to serum deprivation

Our previous studies have shown an essential role played by the octapeptide repeat region (OR) and the N‐terminal half of hydrophobic region (HR) in the anti‐apoptotic activity of prion protein (PrP). As PrP‐like protein Doppel (Dpl), which structurally resembles an N‐terminally truncated PrP, did not show any anti‐apoptotic activity, we examined apoptosis of HpL3–4 cells expressing Dpl fused to various lengths of the N‐terminal region of PrP to investigate whether the PrP/Dpl fusion proteins retain anti‐apoptotic function. HpL3–4 cells expressing Dpl fused to PrP(1–124) with the OR and N‐terminal half of HR of PrP showed anti‐apoptotic function, whereas Dpl fused to PrP(1–95) with OR did not rescue cells from apoptotic cell death induced by serum deprivation. These results indicate that the OR and N‐terminal half of HR of PrP retains anti‐apoptotic activity similar to full‐length PrP.

Hypoglycemia enhances the expression of prion protein and heat-shock protein 70 in a mouse neuroblastoma cell line

Cellular prion protein (PrPC) expression can be regulated by heat‐shock stress, and we designed the present study to determine whether hypoglycemia could affect PrPC expression. RT‐PCR and Western blotting were used to measure the expression of PrPC and heat‐shock protein (Hsp70) in mouse neuroblastoma (N18) cells cultured 3 hr to 3 days in media deprived of 97.5% (L) or 75% (M) of its glucose. Hypoglycemia caused a concomitant time‐dependent and glucose dose‐dependent increase in PrPC and Hsp70. In addition, hypoglycemia also increased phosphorylated c‐Jun N‐terminal kinase (JNK) protein levels in a time‐dependent manner. The upregulation of PrPC and Hsp70 under hypoglycemic conditions was disrupted by the specific JNK inhibitor SP600125. It was also found from in vitro studies that hypoglycemic conditions induced higher levels of PrPC promoter activity in PrPC promoters containing a heat‐shock element (HSE) than in PrPC promoters lacking HSE. We propose that hypoglycemia‐increased PrPC expression might be due to JNK phosphorylation of a heat‐shock transcriptional factor, which then interacts with HSE in the promoter of PrPC.

Three-exon structure of the gene encoding the rat prion protein and its expression in tissues.

The prion protein (PrP), encoded by a chromosomal gene, is associated with development of the neurodegeneration of prion-induced diseases. Since determination of the complete structure of the gene encoding PrP is important for understanding gene expression in the central nervous system (CNS), the nucleotide (nt) sequence of the isolated whole gene encoding rat PrP (raPrP) was determined. The rat PrP gene (raPrP) spans 16 kilobases (kb) of the rat genome and contains three exons of 19–47 base pairs (bp), 98 bp, and 2 kb separated by two introns of 2.2 kb and 11 kb. The first and second exons are noncoding, while the third exon contains a short 5′ untranslated region, the entire 762-bp open reading frame (ORF), and a 3′ untranslated region. The putative raPrP promoter in the 5′ flanking region contains putative Sp1, AP-1, and AP-2 binding sites without a consensus TATA box. This TATA box-deficient feature, coupled with the presence of a high G+C content and Sp1-binding sites in the raPrP promoter, characterizes it as a housekeeping gene. Analysis of the raPrP cDNA 5′-end showed that raPrP mRNA transcription was initiated at multiple sites. Northern blot analysis showed that the levels of raPrP mRNA varied among rat tissues, with the highest levels found in the brain and placenta. This determination of raPrP nt sequences, including the introns and the 5′ and 3′ flanking regions, may make it possible to elucidate cis-acting elements that regulate the expression of this gene in different tissues and cell lines.

Expression of normal cellular prion protein (PrPc) on T lymphocytes and the effect of copper ion: analysis by wild-type and prion protein gene-deficient mice

The purpose of this report was to determine the effect of prion protein (PrP) gene disruption on T lymphocyte function. Previous studies have suggested that normal cellular prion protein (PrP(c)) binds to copper and Cu(2+) is essential for interleukin-2 (IL-2) mRNA synthesis. In this study, IL-2 mRNA levels in a copper-deficient condition were investigated using T lymphocytes from prion protein gene-deficient (PrP(0/0)) and wild-type mice. Results showed that Cu(2+) deficiency had no effect on PrP(c) expression in Con A-activated splenocytes. However, a delay in IL-2 gene expression was observed in PrP(0/0) mouse T lymphocyte cultures using Con A and Cu(2+)-chelator. These results suggest that PrP(c) expression may play an important role in rapid Cu(2+) transfer in T lymphocytes. The rapid transfer of Cu(2+) in murine T lymphocytes could be one of the normal functions of PrP(c).