Klaus Kaserer

Gastroenteropancreatic neuroendocrine tumours: the current incidence and staging based on the WHO and European Neuroendocrine Tumour Society classification: an analysis based on prospectively collected parameters

As incidence data on gastroenteropancreatic neuroendocrine tumours (GEP-NETs) have so far only been retrospectively obtained and based on inhomogeneous material, we conducted a prospective study in Austria collecting all newly diagnosed GEP-NETs during 1 year. Using the current WHO classification, the tumor, nodes, metastases (TNM) staging and Ki67 grading and the standard diagnostic procedure proposed by the European Neuroendocrine Tumor Society (ENETS), GEP-NETs from 285 patients (male: 148; female: 137) were recorded. The annual incidence rates were 2.51 per 100,000 inhabitants for men, 2.36 per 100,000 for women. The stomach (23%) was the main site, followed by appendix (21%), small intestine (15%) and rectum (14%). Patients with appendiceal tumours were significantly younger than patients with tumours in any other site. About 46.0% were classified as benign, 15.4% as uncertain, 31.9% as well differentiated malignant and 6.7% as poorly differentiated malignant. Patients with benign or uncertain tumours were significantly younger than patients with malignant tumours. Among the malignant tumours of the digestive tract, 1.49% arose from neuroendocrine cells. For malignant gastrointestinal NETs, the incidence was 0.80 per 100,000: 40.9% were ENETS stage I, 23.8% stage II, 11.6% stage III and 23.8% stage IV. The majority (59.7%) were grade 1, 31.2% grade 2 and 9.1% grade 3. NETs of the digestive tract are more common than previously reported; the majority show benign behaviour, are located in the stomach and are well differentiated. G3 tumours are very rare.

Risk Factors for Malignancy of Thyroid Nodules Initially Identified as Follicular Neoplasia by Fine-Needle Aspiration: Results of a Prospective Study of One Hundred Twenty Patients

Indeterminate or suspicious findings on fine-needle aspiration (FNA) of nodular thyroid disease (i.e., findings that neither give immediate indication for surgery nor lead to clear-cut conservative management) have been the key diagnostic problem in thyroid cytology for which the inability to differentiate cytologically benign from malignant follicular growth has been one reason. The aim of this cohort study of 120 consecutive (103 females, 17 males) patients with palpable nodular thyroid disease diagnosed as follicular neoplasia (FN) by FNA (defined by the triad of high numbers of follicular cells, microfollicular arrangement, and scanty or absent colloid) was to identify patients at high risk for malignancy based on the prospective evaluation of clinical features and to characterize the histologic entities of FN. Based on a 100% surgery rate we found an 18% malignancy rate (12 papillary carcinomas, 9 follicular carcinomas). Previously suggested factors with elevated risk for malignancy such as extremes of age, male gender, and large nodule size were not associated with increased risk as were cold nodules by 99mTc-scintigraphy (relative risk: 1.2, 95% confidence interval [CI] 0.4-3.3). However, hard lesions to palpation (relative risk 2.6, 95% CI: 1.2-5.6), solitary (relative risk: 2.6, 95% CI: 1.7-4.0), and hypoechoic FNs (relative risk: 3.4, 95% CI: 2.0-5.7) by ultrasound showed elevated risks of malignancy. In summary, suspicious palpation or ultrasound results may help to define a subgroup of patients with elevated risk of malignancy when FNA indicates the diagnosis of follicular neoplasm of the thyroid.

The relation of iron status and hemochromatosis gene mutations in patients with chronic hepatitis C

BACKGROUND & AIMS Elevated hepatic iron concentration may affect the response to antiviral therapy in chronic hepatitis C. This study explored the contribution of genetic hemochromatosis to iron accumulation in chronic hepatitis C. METHODS HFE mutations (C282Y and H63D) were assessed in 184 patients with chronic hepatitis C virus and 487 controls. Liver biopsy specimens were available in 149 patients. Hepatic iron content was measured in 114 patients by atom-absorption spectrophotometry. RESULTS The C282Y and H63D allele frequencies were 7.06 and 11.6 in patients and 4.83 and 11.09 in controls, respectively. Eight patients were homozygotes (5 C282Y [2.7%] and 3 H63D [1.6%]), 2 compound heterozygotes (1%), and 49 heterozygotes (14 C282Y [7.6%] and 35 H63D [19%]). Biochemical evidence of iron overload was more common in patients with HFE mutations (28 of 47) than in those without (34 of 102; P = 0.0045). Histological iron grading and hepatic iron content overlapped among patients with or without mutations. A hepatic iron index of >1.9 was observed only in 1 of the 4 C282Y homozygotes and 1 of the 3 H63D homozygotes. CONCLUSIONS HFE mutations contribute to but do not fully explain hepatic iron accumulation in chronic hepatitis C. Furthermore, C282Y or H63D homozygosity in chronic hepatitis C is not necessarily associated with a high hepatic iron content.

Long‐term follow‐up of patients with bone metastases from differentiated thyroid carcinoma – surgery or conventional therapy?

objective Surgery of bone metastases from differentiated thyroid carcinoma seems indicated in individual patients. This study was performed (1) to analyse retrospectively patients with bone metastases from differentiated thyroid carcinoma and (2) to evaluate the impact of surgery of bone metastases on survival.

Anaplastic (undifferentiated) thyroid carcinoma (ATC)

Background: Old age, reduced general condition and far advanced tumor stage associated with poor prognosis induced the belief that, apart from verifying the diagnosis of anaplastic thyroid carcinoma (ATC) by biopsy, no additional surgery would be justified. However, in some cases, an ultraradical approach was recommended in order to improve the quality of life and survival. Methods: These are the results of a retrospective analysis involving 120 patients subjected to restricted radical surgery (excising as much as possible of the tumor and local metastases, foregoing ultraradical removal of vital organs such as esophagus, larynx and trachea). Results: Irrespective of the surgical approach used, 6±2% of the patients were alive after 5 years (median survival time: 3.1 months). Patients without tumor residues (R0-resections; extending to soft tissue only; Kaplan-Meier estimate – cumulative survival 15±5%) had a significantly better prognosis than patients with tumor residues (R1/R2-resections; no patient survived 5 years; P<0.001). Tumor morphology (spindle cells, giant cells, mixed cells) or differentiated parts of the tumor as well as lymph-node involvement had no statistically significant impact on the prognosis. Conclusions: In ATC, the objective should be to remove as much of the carcinoma as possible (in the ideal case, a thyroidectomy); if lymph nodes are affected, neck dissection should be the goal, if possible (restricted radical approach, improving quality of life). Ultradical surgery to include segmental resection of larynx, trachea or esophagus do not seem to be indicated, as prolonged survival is questionable and quality of life is certainly diminished.

C-cell hyperplasia and medullary thyroid carcinoma in patients routinely screened for serum calcitonin.

Routine screening of calcitonin serum levels in patients with nodular thyroid disorders has led to an increased rate of total thyroidectomies. We investigated prevalence and interrelationship of C-cell hyperplasia (CCH) and medullary thyroid carcinoma (MTC) in patients with thyroid and parathyroid disorders that showed increased calcitonin serum levels detected by routine screening. Within two years, 30 (mean age, 60 +/- 14 years) of 667 patients had a pentagastrin-stimulated calcitonin level of more than 100 pg/mL. All 30 underwent total thyroidectomy and were tested for germ-line mutations of the ret protooncogene. Entire surgical specimens were blocked, and C-cell disorders were assessed using conventional histology and immunohistochemistry. C-cell hyperplasia was defined by the presence of more than 50 C cells/l low-power field in both lobes and was classified as focal, diffuse, nodular, or neoplastic. Nineteen patients (female/male = 14/5) had MTC, and 11 males but no females had CCH only. Six of 16 patients with sporadic MTC had concomitant CCH. Three patients were index cases of new MTC families. We conclude that MTC with concomitant CCH is an unreliable marker for hereditary MTC risk and that CCH has a preneoplastic potential in the absence of germ-line mutations. In this series, CCH alone was not found in females.

Sporadic versus familial medullary thyroid microcarcinoma: A histopathologic study of 50 consecutive patients

By means of calcitonin screening programs, sporadic and hereditary medullary thyroid carcinoma (MTC) can be detected at an early stage. We investigated the histopathologic findings of 16 familial (mean age 32 ± 21 years, female/male ratio 1.6:1) and 34 sporadic (mean age 58 ± 15 years; female/male ratio 2.4:1) MTCs with stage T1 comparatively. Patients with hereditary tumors were younger. Hereditary tumors were more often found multifocal (13 of 16 vs 3 of 34; p <0.001), bilateral (11 of 16 vs 3 of 34; p <0.001), displaying desmoplastic stroma (14 of 16 vs 19 of 34; p = 0.02), and accompanied by C cell hyperplasia (16 of 16 vs 24 of 34; p = 0.01), but all of these factors were present in some sporadic patients. Only tumors with desmoplastic stroma showed lymph node metastasis, which was observed in eight of the 50 patients. After surgery all patients showed permanent normalization of calcitonin levels. We conclude that 1) morphologic parameters considered to indicate familial MTC risk are of no value in the individual patient, 2) many sporadic MTCs develop on the background of CCH, 3) tumors with desmoplastic stroma are more likely to develop lymph node metastasis, and 4) early detection of MTC permits curative surgery in the majority of patients.

DOTA-Lanreotide: A Novel Somatostatin Analog for Tumor Diagnosis and Therapy*

Long acting somatostatin-14 (SST) analogs are used clinically to inhibit tumor growth and proliferation of various tumor types via binding to specific receptors (R). We have developed a 111In-/90Y-labeled SST analog, DOTA-(d)βNal1-lanreotide (DOTALAN), for tumor diagnosis and therapy. 111In-/90Y-DOTALAN bound with high affinity (dissociation constant, Kd, 1–12 nm) to a number of primary human tumors (n = 31) such as intestinal adenocarcinoma (n = 17; 150-4000 fmol/mg protein) or breast cancer (n = 4; 250-9000 fmol/mg protein). 111In-/90Y-DOTALAN exhibited a similar high binding affinity (Kd, 1–15 nm) for the human breast cancer cell lines T47D and ZR75–1, the prostate cancer cell lines PC3 and DU145, the colonic adenocarcinoma cell line HT29, the pancreatic adenocarcinoma cell line PANC1, and the melanoma cell line 518A2. When expressed in COS7 cells, 111In-DOTALAN bound with high affinity to hsst2 (Kd, 4.3 nm), hsst3 (Kd, 5.1 nm), hsst4 (Kd, 3.8 nm), and hsst5 (Kd, 10 nm) and with lower affinity to hsst1...

How accurate is MR imaging in characterisation of adrenal masses: update of a long-term study

OBJECTIVE The purpose of this study was to update a long-term study that evaluates the accuracy of MR imaging in the characterisation of adrenal tumours. In all patients, MR imaging findings were correlated with histopathologic results. PATIENTS In 204/560 patients who underwent MR imaging for characterisation of an adrenal mass, histopathologic results were available. The final study group consisted of 229 adrenal masses in 204 patients. MR imaging was performed using T2-weighted fast spin-echo imaging and unenhanced and gadolinium-enhanced T1-weighted spin-echo imaging in all patients. In addition, chemical shift imaging was performed in 182 patients and dynamic gadolinium-enhanced studies in 198 patients. Chemical shift images and dynamic studies were qualitatively assessed. All images were reviewed by an experienced investigator (Gertraud Heinz-Peer) who was blinded to the clinical history and the results of prior imaging studies. RESULTS The sensitivity of MR imaging for the differentiation of benign and malignant adrenal masses was 89%, the specificity 99%, and the accuracy was 93.9%. This results in a positive predictive value (PPV) of 90.9% and a negative predictive value (NPV) of 94.2%. These results are comparable to the data published previously by our study group with a lower number of cases. CONCLUSION Large study numbers show that MR imaging is a reliable method in characterisation of benign and malignant adrenal masses. Since laparoscopic adrenalectomy has become the new gold standard in the surgical treatment of benign adrenal lesions, the high accuracy of MR imaging in characterisation of those lesions offers even patients with large adrenal masses (>5 cm) the advantages of the minimally invasive technique.

Detection of the His1069Gln Mutation in Wilson Disease by Rapid Polymerase Chain Reaction

Wilson disease is an autosomal recessive genetic disorder of biliary copper excretion that results in the progressive accumulation of copper in various organs, such as the liver and brain, and in the cornea [1]. Among patients with Wilson disease, the age of onset and clinical presentation vary greatly [2-4]. Diagnosis may be difficult in the absence of typical symptoms and in asymptomatic siblings because all biochemical markers of impaired copper metabolism can be normal [5, 6]. However, early diagnosis is essential because lifelong treatment with copper chelating agents or oral zinc prevents brain damage and liver cirrhosis [7]. After the Wilson disease gene was mapped to chromosome 13q14.3, linkage analysis became available for preclinical testing [8]. This DNA-based diagnostic test can be done only in siblings of an index patient whose diagnosis was made according to phenotypic criteria and only if DNA from both parents is available. The detection of more than 50 different mutations in the Wilson disease gene (ATP7B) represents a significant step toward direct genetic diagnosis [9]. Most of these mutations occur in only a few families or patients. In contrast, the His 1069Gln mutation is far more frequent and is present in at least one third of patients of Northern or Eastern European origin who have Wilson disease [9, 10]. This point mutation (CA transversion in exon 14) results in a change from histidine to glutamine at amino acid position 1069. We developed a semi-nested, rapid polymerase chain reaction (PCR) method to detect the His1069Gln mutation and used it to determine the distribution of this mutation in 83 patients with Wilson disease and family members of homozygous patients in Austria. We then correlated the mutation status with clinical findings and liver histologic findings. Methods Patients Eighty-three patients with Wilson disease from 72 families were consecutively examined. Sixty-three patients received a diagnosis and were followed at the Department of Gastroenterology and Hepatology, University of Vienna, Austria; 7 were seen at the University Hospital of Innsbruck, Austria; and 3 were seen at the University Hospital of Graz, Austria. For these 73 patients, serial clinical data (including liver histologic findings, quantitative hepatic copper content, and results of electroencephalography and neurologic magnetic resonance studies) were available from the time of diagnosis and were collected over a 15-year period. Data on the remaining 10 patients were supplied by referring physicians. All families of index patients who were homozygous for the His1069Gln mutation were contacted for screening. Blood samples were collected from all living persons with Wilson disease and their parents, siblings, and more distant relatives (such as grandparents, uncles, and aunts). Wilson disease was diagnosed on the basis of typical symptoms, the presence of Kayser-Fleischer rings seen by slit lamp, and conventional biochemical indicators (low serum concentrations of copper and ceruloplasmin; elevated excretion of urinary copper during a 24-hour period; and, in most cases, increased levels of hepatic copper). Details of the molecular genetic analysis used to diagnose Wilson disease in one asymptomatic sibling have recently been reported [11]. Biochemical Analysis Serum ceruloplasmin levels (normal level, 200 to 600 mg/L) were measured by using radial immunodiffusion (NOR-Partigen Coeruloplasmin, Behring, Marburg, Germany). Levels of glutamate pyruvate aminotransferase, glutamate oxaloacetate aminotransferase, bilirubin, and -glutamyltranspeptidase were measured by using standard methods. Copper content (normal level < 50 g/g dry weight) in dried liver tissue was determined by flame atomic-absorption spectroscopy according to the method described by Kingston and Jassie [12]. Liver Histologic Analysis Liver biopsy specimens were evaluated in a blinded manner by an experienced pathologist using both a conventional descriptive diagnosis (chronic persistent hepatitis, chronic active hepatitis, cirrhosis, steatosis, and fibrosis) and Scheuers classification system [13]. All biopsy specimens were obtained at diagnosis before the start of treatment. DNA Analysis High-molecular-weight DNA was isolated from whole peripheral blood or lysed mononuclear cells according to standard procedures. Using the intronic primers 3348 and 3349 as previously described [14], we did PCR to amplify exon 14 (the location of the His1069Gln mutation) of the Wilson disease gene from samples of 100 to 200 ng of genomic DNA. The reactions were done in a total volume of 50 L that contained 2 mmol of MgCl2 per L, 200-mol concentrations of each deoxynucleoside triphosphate per L, 50 pmol of each primer, and 0.15 U of Dynazyme-DNA Polymerase (Finnzymes, Espoo, Finland). Thirty-three amplification cycles were performed in a Perkin-Elmer 2400 thermocycler (Foster City, California). Each cycle consisted of denaturation at 94 C for 20 seconds, annealing at 58 C for 30 seconds, and extension at 72 C for 25 seconds. After completion of the first PCR test, the resulting product of 337 base pairs (representing exon 14 of the Wilson disease gene) was used as a template for the second PCR test, in which the mismatch primer MUT 1070 = 5 TGCGCAGGCCAGCAGTGAGC3 (mismatch in italics) and the complementary intronic primer 3348 from the exon amplification were used. In this second test, a restriction site is created in wild-type DNA but not in the mutated chromosome. This difference can be used to detect the mutation by digesting the product of this reaction for 2 hours with the restriction enzyme BsiHKA I under the buffer and temperature conditions recommended by the manufacturer (New England Biolabs, Beverly, Massachusetts). The digested samples were then subjected to electrophoresis through a 9% nondenaturing polyacrylamid gel and stained with ethidium bromide. Fragments of DNA were photographed under ultraviolet transillumination. The mutation could then be detected by demonstration of a different migration velocity on the gel. The electrophoretic separation of the alleles after digestion of the PCR product allows the determination of the His1069Gln mutation status (Figure 1). Incomplete digestion of the primary PCR product by BsiHKA I was excluded by several control experiments. In each set of PCR reactions, DNA from known homozygotes, heterozygotes (healthy carriers), compound heterozygotes (persons with symptomatic Wilson disease), and healthy controls was amplified and digested simultaneously under identical reaction conditions. The reliability of this method was also tested in a group of 30 healthy controls. Figure 1. Separation of alleles after digestion with the restriction enzyme BsiHKA I. Statistical Analysis Data on age, symptoms, and liver biopsy findings at presentation were analyzed in the index patients only. An unpaired Student t-test or chi-square test was used to calculate the significance levels of 2 2 contingency tables. A P value of 0.05 or less was considered significant. In most cases, 95% CIs are provided for the ratios of proportions of the number of women and neurologic symptoms and for the mean differences of age at symptom onset and age at diagnosis [15]. Data are given as the mean SD unless otherwise noted. We used SIGMA STAT Statistical Software, Version 1.0 (Jandel Scientific Corp., San Rafael, California). Results Twenty index patients (including 5 siblings) were homozygous for the His1069Gln mutation, and 33 (including 4 siblings) were compound heterozygotes. The mutation was not detected in 30 patients (including 2 siblings); these patients were classified as having other mutations. Thus, the His1069Gln mutation was present in 61% of the Austrian patients with Wilson disease in our study. Important differences were seen among the three groups. First, patients who were homozygous for the His1069Gln mutation were older at the time of symptom onset (24 6 years of age) than were compound heterozygotes (17 6 years [CI, 3.3 to 10.7 years]; P = 0.0135) and patients with other mutations (18 8 years [CI, 1.8 to 10.2 years]; P = 0.117) (Figure 2). No homozygote younger than 16 years of age presented with symptoms. Second, sex distribution differed markedly for the three groups; 73.3% of homozygotes were women compared with 48% of heterozygotes (CI, 0.94% to 2.46%) and 50% of patients with other mutations (CI, 0.91% to 2.37%) (P = 0.05). Finally, homozygotes had neurologic symptoms more frequently (73.3%) than did heterozygotes (37.9% [CI, 0.1% to 3.4%]) and patients with other mutations (35.7% [CI, 1.1% to 3.7%]). Figure 2. Correlation of genotype with age at symptom onset. Liver biopsy findings did not differ significantly among the three groups, but liver disease was less severe in homozygotes. Liver biopsy results were available for 20 homozygotes (7 with cirrhosis, 6 with chronic hepatitis, and 7 with steatosis or fibrosis), 27 heterozygotes (8 with cirrhosis, 12 with chronic hepatitis, and 7 with steatosis or fibrosis), and 23 patients with other mutations (12 with cirrhosis, 5 with chronic hepatitis, and 6 with steatosis or fibrosis). Symptomatic liver disease was diagnosed in 7 homozygotes (46.7%), 18 compound heterozygotes (62%), and 18 patients with other mutations (64.3%). Liver copper content was assayed in 15 homozygotes (770 153 g/g), 13 heterozygotes (1051 207 g/g), and 16 patients with other mutations (1119 343 g/g). The three groups did not differ significantly for symptomatic liver disease or hepatic copper content. Table 1 shows the clinical characteristics of patients who were homozygous for the His1069Gln mutation. Seven patients presented with liver disease; in two, diagnosis was delayed for many years and was only made when neurologic symptoms occurred. Eight patients presented with neurologic or psychiatric disorders such as tremor, ataxia, dysarthria, and depression. Patient 1 initially presented with liver