L. A. Zheleznaya

Structural analysis of the heterodimeric type IIS restriction endonuclease R.BspD6I acting as a complex between a monomeric site-specific nickase and a catalytic subunit.

The heterodimeric restriction endonuclease R.BspD6I from Bacillus species D6 recognizes a pseudosymmetric sequence and cuts both DNA strands outside the recognition sequence. The large subunit, Nt.BspD6I, acts as a type IIS site-specific monomeric nicking endonuclease. The isolated small subunit, ss.BspD6I, does not bind DNA and is not catalytically active. We solved the crystal structures of Nt.BspD6I and ss.BspD6I at high resolution. Nt.BspD6I consists of three domains, two of which exhibit structural similarity to the recognition and cleavage domains of FokI. ss.BspD6I has a fold similar to that of the cleavage domain of Nt.BspD6I, each containing a PD-(D/E)XK motif and a histidine as an additional putative catalytic residue. In contrast to the DNA-bound FokI structure, in which the cleavage domain is rotated away from the DNA, the crystal structure of Nt.BspD6I shows the recognition and cleavage domains in favorable orientations for interactions with DNA. Docking models of complexes of Nt.BspD6I and R.BspD6I with cognate DNA were constructed on the basis of structural similarity to individual domains of FokI, R.BpuJI and HindIII. A three-helix bundle forming an interdomain linker in Nt.BspD6I acts as a rigid spacer adjusting the orientations of the spatially separated domains to match the distance between the recognition and cleavage sites accurately.

Regulatory C Protein of the EcoRV Modification-Restriction System

The C gene product of the modification–restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification–restriction systems.

Plasmid pRARE as a vector for cloning to construct a superproducer of the site-specific nickase N.BspD6I.

The gene of methylase M.SccL1I that protects DNA against hydrolysis with the nickase N.BspD6I was inserted into plasmid pRARE carrying genes of tRNA, which are rare in E. coli. The insertion of the gene sscML1I into pRARE was reasoned by incompatibility of pRARE and the plasmid carrying the gene sscML1I, because both plasmids contained the same ori-site. Upon transformation of E. coli TOP10F′ cells with both the recombinant plasmid pRARE/MSsc and the expression vector pET28b containing the nickase gene bspD6IN under the phage T7 promoter, a strain of E. coli was obtained which produced 7 ·105 units of the nickase N.BspD6I per 1 g wet biomass, and this yield was two orders of magnitude higher than the yield of the enzyme from the strain free of pRARE/MSsc.

Nickase and a protein encoded by an open reading frame downstream from the nickase BspD6I gene form a restriction endonuclease complex.

We are the first to have isolated a protein (186 amino acid residues) encoded by the open reading frame adjacent to the end of the BspD6I nickase (N.BspD6I) gene. Cleavage of both DNA strands near the sequence recognized by nickase (5′-GAGTC/5′-GACTC) occurs when this protein is added to the reaction mixture containing N.BspD6I. The protein encoded by the open reading frame and the nickase are suggested to be subunits of heterodimeric restriction endonuclease R.BspD6I.

Some Properties of Site-Specific Nickase BspD6I and the Possibility of Its Use in Hybridization Analysis of DNA

A new method for hybridization analysis of nucleic acids is proposed on the basis of the ability of site-specific nickases to cleave only one DNA strand. The method is based on the use of a labeled oligonucleotide with the recognition site of the nickase hybridized with the target (DNA or RNA) at an optimal temperature of the enzyme (55°C). The two shorter oligonucleotides formed after the cleavage with the nickase do not complex with the target. Thus, a multiple cleavage of the labeled oligonucleotide takes place on one target molecule. The cleavage of the nucleotide is recorded either by polyacrylamide gel electrophoresis (when a radioactive labeled oligonucleotide is used) or by fluorescence measurements (if the oligonucleotide has the structure of a molecular beacon). The new method was tested on nickase BspD6I and a radioactive oligonucleotide complementary to the polylinker region of the viral DNA strand in bacteriophage M13mp19. Unfortunately, nickase BspD6I does not cleave DNA in the RNA–DNA duplexes and therefore cannot be used for detection of RNA targets.

Crystallization and preliminary crystallographic analysis of the site-specific DNA nickase Nb.BspD6I.

Crystals of site-specific DNA nickase Nb.BspD6I (of molecular weight 70.8 kDa) have been grown at 291 K using PEG 8000 as precipitant. The diffraction pattern of the crystal extends to 3.3 A resolution at 100 K. The crystal belongs to space group P2(1), with unit-cell parameters a = 57.76, b = 90.67, c = 71.71, beta = 110.1 degrees. There is one molecule in the asymmetric unit and the solvent content is estimated to be 53% by volume.

Isolation and Characterization of Site-Specific DNA-methyltransferases from Bacillus coagulans K

Two site-specific DNA methyltransferases, M.BcoKIA and M.BcoKIB, were isolated from the thermophilic strain Bacillus coagulans K. Each of the methylases protects the recognition site 5′-CTCTTC-3′/5′-GAAGAG-3′ from cleavage with the cognate restriction endonuclease BcoKI. It is shown that M.BcoKIB is an N6-adenine specific methylase and M.BcoKIA is an N4-cytosine specific methylase. According to bisulfite mapping, M.BcoKIA methylates the first cytosine in the sequence 5′-CTCTTC-3′.

Crystallization and preliminary X-ray diffraction analysis of the small subunit of the heterodimeric restriction endonuclease R.BspD6I.

The heterodimeric restriction endonuclease R.BspD6I is composed of a small subunit with a cleavage site and a large subunit, containing a recognition domain and a cleavage domain, that may function separately as a monomeric nicking endonuclease. Here, the crystallization of the small subunit and diffraction data collection to 1.5 A resolution are reported.

Location of the Bases Modified by M.BcoKIA and M.BcoKIB Methylases in the Sequence 5′-CTCTTC-3′/5′-GAAGAG-3′

The strain Bacillus coagulans K contains two DNA-methyltransferases, M.BcoKIA and M.BcoKIB, which recognize the sequence 5′-CTCTTC-3′/5′-GAAGAG-3′ and possess N4-methylcytosine and N6-methyladenine specificities, respectively. A special construct containing the recognition site of BcoKI and sites of four IIS restriction endonucleases (IIS restriction endonuclease cassette) was designed to locate the nucleotides modified by the methylases. The modified bases were determined as: 5′-m4CTCTTC-3′/5′-GAAGAm6G-3′.

Global conformational changes induced by the removal of the carboxyl group of D456 in the cleavage scaffold of nickase BspD6I: Structural and electrostatic analysis

The three-dimensional structure of the D456A mutant of the nicking endonuclease Nt.BspD6I was determined. According to the concept of the cleavage scaffold, the replacement of D456 by A456, which resulted in complete (100%) loss of nickase activity, was shown to be a trigger of structural changes in the cleavage-scaffold region. Besides, the displacement of Е482 and the rotation of Н449 toward the N-terminal domain initiate conformational changes in the D1 recognition subdomain of the N-terminal domain with the result that the centers of mass of the С- and N-terminal domains are brought into close proximity to each other. Electrostatic calculations showed that changes in the free energy and electrostatic interactions for the mutant nickase are distributed predominantly in the N-terminal domain and that these changes are not attenuated in a radial fashion away from the mutation site but have a distinct direction.