L. M. Lee

Emergence and diversity of begomoviruses infecting solanaceous crops in East and Southeast Asia.

Over the past three decades diseases caused by whitefly-transmitted geminiviruses (begomoviruses) have emerged to be important constraints to the production of solanaceous crops, particularly tomato (Solanum lycopersicum) and peppers (Capsicum spp.), in many tropical and subtropical regions of the world. The most studied of these is Tomato yellow leaf curl virus (TYLCV), which has spread to many other areas from its likely origin in the Mediterranean basin region. The virus is usually associated with the polyphagous and virus-vectoring-efficient B-biotype of its vector whitefly (Bemisia tabaci). However, in Southeast and East Asia, a wide variety of distinct local begomovirus species have been identified from tomato and pepper crops over this period, and TYLCV was detected in Japan only in about 1996, China in 2006 and Korea in 2008, despite B-biotype whiteflies being present in several of the countries of the region since at least the early 1990s. Continental Southeast Asia appears to be a major center of diversity for begomoviruses and some species may have spread across the region; Tomato yellow leaf curl Thailand virus (TYLCTHV) appears to have spread from the Thailand-Myanmar region into southern China and is now displacing the local tomato-infecting species in Taiwan, and Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) appears to have spread from the Thailand-Vietnam region to Java, Indonesia. Since many of the native tomato- or pepper-infecting begomoviruses and associated satellite DNAs have also been detected in local weed species, it seems likely that their ancestors originated in these weed hosts, but with the expansion and intensification of tomato and pepper production in the region, there was selection for recombinant or mutant forms with greater virulence on tomato and/or pepper. Expansion and intensification of these crops may also have resulted in increased populations of local, and if present, B- or Q-biotype whiteflies, aiding the increase and spread of local begomovirus species.

First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana

Tomato leaf curl disease is reported to be widespread in Ghana and to cause severe yield losses (4). So far, the causal agent has not been identified. Thirty-three tomato (Solanum lycopersicum L.) samples with symptoms such as curling, yellowing, small leaves, and stunting were collected from the Ashanti Region, the main tomato-production area in Ghana, including three samples from Akumandan in the autumn of 2007 and 30 samples from Kumasi in the spring of 2008. The observed leaf curl disease incidence in the farmers field in Kumasi was approximately 75%. Viral DNAs were extracted from the 33 samples and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR with previously described primers (1,3). The expected 1.4-kb DNA-A begomovirus fragment was obtained from one of the samples from Akumadan and from 25 samples from Kumasi. DNA-B and DNA-beta were not detected by PCR. The 1.4-kb PCR products from all positive samples were cloned and sequenced. Sequence comparison by MegAlign software (DNASTAR, Inc., Madison, WI) showed three distinct virus groups. One isolate from each group was selected and specific primers were designed to complete the DNA-A sequence. The DNA-As of GH5-3 (group 1), GOTB2-2 (group 2), and GHK2 (group 3) isolates consisted of 2,803 (GenBank Accession No. EU350585), 2,794 (GenBank Accession No. EU847739), and 2,792 nt (GenBank Accession No. EU847740) respectively. All contain the geminiviral conserved nonanucleotide sequence TAATATTAC in the intergenic region and the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). BLASTn analysis was conducted with geminivirus sequences available in the GenBank database at National Center for Biotechnology Information (Bethesda, MD). Further sequence comparisons were performed by Clustal V algorithm of MegAlign software with the representative isolates of begomovirus species reported by Fauquet et al (2) and the sequences that showed high scores in BLASTn search. The DNA-A sequence of isolate GHK2 from Kumasi showed highest sequence identity (96.5%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accesssion No. AY502934). The DNA-A sequence of GH5-3 and GOTB2-2 isolates had 87.5% sequence identity with each other. Both had highest sequence identities of 76.7 and 77.6%, respectively, with Tomato leaf curl Antsiranana virus, Madagascar (GenBank Accession No. AM701764). They constitute two distinct begomovirus species based on DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity. The names Tomato leaf curl Ghana virus for isolate GH5-3 and Tomato leaf curl Kumasi virus for isolate BOTB2-2 are proposed, respectively. To our knowledge, this is the first report of molecular characterization of begomoviruses associated with tomato leaf curl disease in Ghana and of the presence of three distinct tomato begomoviruses. This presence should be considered for recommending or developing stable begomovirus resistant tomato cultivars for Ghana. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) D. Horna et al., eds. Online publication. Int. Food Policy Res. Inst. PBS Policy Brief 2, 2007.

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-β from Niger

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-β satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-β satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-β from Niger. The begomovirus and DNA-β have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

First report of a begomovirus associated with Tomato yellow leaf curl disease in Ethiopia.

During December 2003, severe leaf yellowing, leaf curling, and stunting symptoms were observed in tomato (Lycopersicon esculentum) plantings in Melkassa (1,550 m above sea level), Ethiopia. Eleven symptomatic samples were collected and tested for the presence of a begomovirus using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3). Samples were also tested for Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tobacco etch virus (TEV), Pepper veinal mottle virus (PVMV), and Tomato mosaic virus (ToMV) using enzyme-linked immunosorbent assay (ELISA). All samples were negative for CMV, PVY, TEV, PVMV, and ToMV. However, the expected 1.4-kb PCR product for begomoviruses was obtained from all samples. DNA-B and DNA-beta were not detectable using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/ DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. The 1.4-kb PCR product of one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,785 nucleotides (GenBank Accession No. DQ358913) and was found to contain the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The DNA-A sequence of the virus associated with yellow leaf curl disease of tomato from Ethiopia showed highest sequence identity (92%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accession No. AY502934). On the basis of the DNA-A sequence comparison and the ICTV demarcation of species at 89% sequence identity, the Ethiopian virus is a provisional strain of TYLCMLV described from Mali. To our knowledge, this is the first report of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmers field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)

Brownes Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Brownes Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.