Lars Rönnblom

Role of Natural Interferon-α Producing Cells (Plasmacytoid Dendritic Cells) in Autoimmunity

The type I interferons (IFNs) have antiviral, cytostatic and prominent immunomodulatory effects, which all are of great importance during viral infections. However, prolonged exposure of the immune system to type I IFN can break tolerance and initiate an autoimmune reaction, eventually leading to autoimmune disease. Recent observations in patients with systemic lupus erythematosus (SLE) have revealed that such individuals have endogenous IFN-α inducers, causing an ongoing IFN-α production and consequently a continuous stimulation of the immune system. These IFN-α inducers consist of small immune complexes (IC) containing DNA or RNA and act on the principal IFN-α producing cell, the natural IFN-α producing cell (NIPC), also termed the plasmacytoid dendritic cell (PDC). The NIPC/PDC is a key cell in both the innate and adaptive immune response but can also, either directly or via produced IFN-α, have a pivotal role in autoimmunity. In this review we summarize recent data concerning NIPC/PDC, including their activation, regulation, function and possible role in autoimmune diseases, especially SLE.

Importance of CpG dinucleotides in activation of natural IFN-alpha-producing cells by a lupus-related oligodeoxynucleotide

The oligodeoxyribonucleotide (ODN) 5‐TTTTCAATTCGAAGATGAAT‐3 (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)‐α in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN‐α, showed that the IFN‐α‐producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single‐stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG‐methylated double‐stranded (ds) ODN Hmet‐Imet lost, but hemimethylated dsODN H‐Imet retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H‐I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN‐α is therefore sequence‐specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.

Type I interferons in Sjögren's syndrome.

Sjögrens syndrome is a chronic autoimmune disease characterized by lymphocytic infiltration of the salivary and lachrymal glands resulting in dry eyes and mouth. Genetic predisposition, pathogenic infections and hormones have been implicated in the pathogenesis of the disease. Studies in the last several years have revealed marked over-expression of the type I interferon (IFN)-inducible genes in the peripheral blood and salivary glands of patients with Sjögrens syndrome. The expression of the type I IFN-inducible genes in Sjögrens syndrome also positively correlates to titers of anti-Ro and anti-La autoantibodies, which are typical for this disease. Plasmacytoid dendritic cells (pDC) are the major source of type I IFN production and activated pDC are detected in minor salivary gland biopsies from patients with primary Sjögrens syndrome. In addition, polymorphisms in genes important both for the production and response to type I IFN are associated to increased risk for Sjögrens syndrome. Because type I IFN bears a variety of biological functions, such as defense against viral infections and activation of the immune system, these results suggest that the type I IFN system has an important role in the pathogenesis of Sjögrens syndrome. A variety of mechanisms causing an activation of the type I IFN system are discussed in this review. Given the pivotal role of type I IFN in the disease process, therapeutic interventions targeting the type I IFN signaling pathway have the potential to benefit the patients with elevated type I IFN status and such hypothesis needs to be carefully evaluated in clinical development.

Potential role of IFNα in adult lupus

Patients with lupus have a continuous production of IFNα and display an increased expression of IFNα-regulated genes. The reason for the ongoing IFNα synthesis in these patients seems to be an activation of plasmacytoid dendritic cells (pDCs) by immune complexes (ICs), consisting of autoantibodies in combination with DNA-containing or RNA-containing autoantigens. The mechanisms behind the activation of pDCs by such ICs have to some extent been elucidated during the last years. Thus, interferogenic ICs are internalized via the FcγRIIa expressed on pDCs, reach the endosomes and stimulate Toll-like receptor (TLR) 7 or 9, which subsequently leads to IFNα gene transcription. Variants of genes involved in both the IFNα synthesis and response have been linked to an increased risk to develop lupus. Among these genes are interferon regulatory factor 5 (IRF5), which is involved in TLR signaling, and the signal transducer and activator of transcription 4 (STAT4) that interacts with the type I interferon receptor. Produced IFNα may at least partially be responsible for several of the observed alterations in the immune system of lupus patients and contribute to the autoimmune disease process, which will be discussed in the present review. How produced IFNα can contribute to some clinical manifestations will briefly be described, as well as the possible consequences of this knowledge in clinical practice for disease monitoring and therapy

Glucocorticoid resorption and influence on the hypothalamic-pituitary-adrenal axis after intra-articular treatment of the knee in resting and mobile patients

Background: Studies have shown that intra-articular glucocorticoid injection treatment for knee synovitis has a better outcome in resting patients than in mobile patients. One reason for this observation might be that rest retards steroid resorption, causing an enhanced local treatment effect. Objectives: To study drug resorption and the impact on hormone production in the hypothalamic-pituitary-adrenal axis after intra-articular glucocorticoid administration, with and without postinjection rest. Methods: Twenty patients with rheumatoid arthritis and knee synovitis were randomised to either 24 hour bed rest or normal activity after intra-articular glucocorticoid treatment with 20 mg triamcinolone hexacetonide (THA). Serum levels of THA, cortisol, and adrenocorticotropic hormone (ACTH) were followed during 2 weeks. Results: Short term and reversible decreases in serum cortisol and ACTH levels (p<0.001) were seen, without any significant differences between resting and mobile patients. The THA levels increased similarly in both groups, with the median serum peak seen after 8 hours. Conclusion: Immobilisation does not appear to retard glucocorticoid resorption after intra-articular administration. Further studies are therefore needed to clarify the mechanism behind the beneficial effects of rest after intra-articular glucocorticoid treatment for knee synovitis.

Randomised controlled study of postinjection immobilisation after intra-articular glucocorticoid treatment for wrist synovitis

Background: Intra-articular glucocorticoid treatment is frequently used in arthritic disorders. Postinjection rest has been shown to improve the outcome of knee injections. Objective: To investigate whether better treatment results might also be achieved by a similar postinjection regimen for the wrist, which is non-weightbearing. Methods: 117 patients with rheumatoid arthritis and wrist synovitis were treated with intra-articular glucocorticoid injections. The patients were randomly allocated to 48 hour postinjection immobilisation in elastic wrist orthoses (n=58) or to normal postinjection activity (n=59). The primary end point was relapse of synovitis. In addition, joint circumference, pain, function, range of movement, and grip strength were followed up during six months. Results: 24 relapses occurred in the orthoses group and 14 in the active group (p=0.056). The secondary measure showed no statistically significant differences between the groups. Conclusion: The use of elastic wrist orthoses as a postinjection regimen does not improve the outcome of intra-articular glucocorticoid treatment for wrist synovitis. Results achieved in studies on knees should not be generalised to other joints, and postinjection recommendations should differ depending on the joint treated.