Lee-Jun C. Wong

Clinical Spectrum, Morbidity, and Mortality in 113 Pediatric Patients with Mitochondrial Disease

Objectives. The aim of this study was to elucidate the frequency of major clinical manifestations in children with mitochondrial disease and establish their clinical course, prognosis, and rates of survival depending on their clinical features. Methods. We performed a retrospective review of the medical records of 400 patients who were referred for evaluation of mitochondrial disease. By use of the modified Walker criteria, only patients who were assigned a definite diagnosis were included in the study. Results. A total of 113 pediatric patients with mitochondrial disease were identified. A total of 102 (90%) patients underwent a muscle biopsy as part of the diagnostic workup. A significant respiratory chain (RC) defect, according to the diagnostic criteria, was found in 71% of the patients who were evaluated. In this cohort, complex I deficiency (32%) and combined complex I, III, and IV deficiencies (26%) were the most common causes of RC defects, followed by complex IV (19%), complex III (16%), and complex II deficiencies (7%). Pathogenic mitochondrial DNA abnormalities were found in 11.5% of the patients. A substantial fraction (40%) of patients with mitochondrial disorders exhibited cardiac disease, diagnosed by Doppler echocardiography; however, the majority (60%) of patients had predominant neuromuscular manifestations. No correlation between the type of RC defect and the clinical presentation was observed. Overall, the mean age at presentation was 40 months. However, the mean age at presentation was 33 months in the cardiac group and 44 months in the noncardiac group. Twenty-six (58%) patients in the cardiac group exhibited hypertrophic cardiomyopathy, 29% had dilated cardiomyopathy, and the remainder (13%) had left ventricular noncompaction. Patients with cardiomyopathy had an 18% survival rate at 16 years of age. Patients with neuromuscular features but no cardiomyopathy had a 95% survival at the same age. Conclusions. This study gives strong support to the view that in patients with RC defects, cardiomyopathy is more common than previously thought and tends to follow a different and more severe clinical course. Although with a greater frequency than previously reported, mitochondrial DNA mutations were found in a minority of patients, emphasizing that most mitochondrial disorders of childhood follow a Mendelian pattern of inheritance.

The in-depth evaluation of suspected mitochondrial disease

Mitochondrial disease confirmation and establishment of a specific molecular diagnosis requires extensive clinical and laboratory evaluation. Dual genome origins of mitochondrial disease, multi-organ system manifestations, and an ever increasing spectrum of recognized phenotypes represent the main diagnostic challenges. To overcome these obstacles, compiling information from a variety of diagnostic laboratory modalities can often provide sufficient evidence to establish an etiology. These include blood and tissue histochemical and analyte measurements, neuroimaging, provocative testing, enzymatic assays of tissue samples and cultured cells, as well as DNA analysis. As interpretation of results from these multifaceted investigations can become quite complex, the Diagnostic Committee of the Mitochondrial Medicine Society developed this review to provide an overview of currently available and emerging methodologies for the diagnosis of primary mitochondrial disease, with a focus on disorders characterized by impairment of oxidative phosphorylation. The aim of this work is to facilitate the diagnosis of mitochondrial disease by geneticists, neurologists, and other metabolic specialists who face the challenge of evaluating patients of all ages with suspected mitochondrial disease.

Molecular and clinical genetics of mitochondrial diseases due to POLG mutations.

Mutations in the POLG gene have emerged as one of the most common causes of inherited mitochondrial disease in children and adults. They are responsible for a heterogeneous group of at least 6 major phenotypes of neurodegenerative disease that include: 1) childhood Myocerebrohepatopathy Spectrum disorders (MCHS), 2) Alpers syndrome, 3) Ataxia Neuropathy Spectrum (ANS) disorders, 4) Myoclonus Epilepsy Myopathy Sensory Ataxia (MEMSA), 5) autosomal recessive Progressive External Ophthalmoplegia (arPEO), and 6) autosomal dominant Progressive External Ophthalmoplegia (adPEO). Due to the clinical heterogeneity, time‐dependent evolution of symptoms, overlapping phenotypes, and inconsistencies in muscle pathology findings, definitive diagnosis relies on the molecular finding of deleterious mutations. We sequenced the exons and flanking intron region from approximately 350 patients displaying a phenotype consistent with POLG related mitochondrial disease and found informative mutations in 61 (17%). Two mutant alleles were identified in 31 unrelated index patients with autosomal recessive POLG‐related disorders. Among them, 20 (67%) had Alpers syndrome, 4 (13%) had arPEO, and 3 (10%) had ANS. In addition, 30 patients carrying one altered POLG allele were found. A total of 25 novel alterations were identified, including 6 null mutations. We describe the predicted structural/functional and clinical importance of the previously unreported missense variants and discuss their likelihood of being pathogenic. In conclusion, sequence analysis allows the identification of mutations responsible for POLG‐related disorders and, in most of the autosomal recessive cases where two mutant alleles are found in trans, finding deleterious mutations can provide an unequivocal diagnosis of the disease. Published 2008 Wiley‐Liss, Inc.

Quantitative PCR Analysis of Mitochondrial DNA Content in Patients with Mitochondrial Disease

Abstract: Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real‐time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5′TTACCGGGCTCTGCCATCT3′‐TAMRA and VIC‐5′AGCAATAACAGGTCTGTGATG3′‐TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5‐20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age‐matched group, and about 10% of patients had muscle mtDNA levels 2‐ to 16‐fold higher than the mean of the age‐matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Mitochondrial DNA polymerase γ mutations: an ever expanding molecular and clinical spectrum

Mutations in the POLG gene have emerged as one of the most common causes of inherited mitochondrial diseases in children and adults. This study sequenced the exons and flanking intronic regions of the POLG gene from 2697 unrelated patients with clinical presentations suggestive of POLG deficiency. Informative mutations have been identified in 136 unrelated individuals (5%), including 92 patients with two recessive pathogenic alleles and three patients harbouring a dominant mutation. Twenty-four novel recessive mutations and a novel possible dominant mutation, p.Y951N, were identified. All missense mutations occurred at evolutionarily conserved amino acids within functionally important regions identified by molecular modelling analyses. Oligonucleotide array comparative genomic hybridisation analyses performed on DNA samples from 81 patients with one mutant POLG allele identified a large intragenic deletion in only one patient, suggesting that large deletions in POLG are rare. The 92 patients with two mutant alleles exhibited a broad spectrum of disease. Almost all patients in all age groups had some degree of neuropathy. Seizures, hepatopathy, and lactic acidaemia were predominant in younger patients. By comparison, patients who developed symptoms in adulthood had a higher percentage of myopathy, sensory ataxia, and chronic progressive external ophthalmoplegia (CPEO)/ptosis. In conclusion, POLG mutations account for a broad clinical spectrum of mitochondrial disorders. Sequence analysis of the POLG gene should be considered as a part of routine screening for mitochondrial disorders, even in the absence of apparent mitochondrial DNA abnormalities.

POLG DNA testing as an emerging standard of care before instituting valproic acid therapy for pediatric seizure disorders

PURPOSE To review our clinical experience and determine if there are appropriate signs and symptoms to consider POLG sequencing prior to valproic acid (VPA) dosing in patients with seizures. METHODS Four patients who developed VPA-induced hepatotoxicity were examined for POLG sequence variations. A subsequent chart review was used to describe clinical course prior to and after VPA dosing. RESULTS Four patients of multiple different ethnicities, age 3-18 years, developed VPA-induced hepatotoxicity. All were given VPA due to intractable partial seizures. Three of the patients had developed epilepsia partialis continua. The time from VPA exposure to liver failure was between 2 and 3 months. Liver failure was reversible in one patient. Molecular studies revealed homozygous p.R597W or p.A467T mutations in two patients. The other two patients showed compound heterozygous mutations, p.A467T/p.Q68X and p.L83P/p.G888S. Clinical findings and POLG mutations were diagnostic of Alpers-Huttenlocher syndrome. CONCLUSION Our cases underscore several important findings: POLG mutations have been observed in every ethnic group studied to date; early predominance of epileptiform discharges over the occipital region is common in POLG-induced epilepsy; the EEG and MRI findings varying between patients and stages of the disease; and VPA dosing at any stage of Alpers-Huttenlocher syndrome can precipitate liver failure. Our data support an emerging proposal that POLG gene testing should be considered in any child or adolescent who presents or develops intractable seizures with or without status epilepticus or epilepsia partialis continua, particularly when there is a history of psychomotor regression.

Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy.

MPV17 is a mitochondrial inner membrane protein of unknown function recently recognized as responsible for a mitochondrial DNA depletion syndrome. The aim of this study is to delineate the specific clinical, pathological, biochemical, and molecular features associated with mitochondrial DNA depletion due to MPV17 gene mutations. We report 4 cases from 3 ethnically diverse families with MPV17 mutations. Importantly, 2 of these cases presented with isolated liver failure during infancy without notable neurologic dysfunction. Conclusion: We therefore propose that mutations in the MPV17 gene be considered in the course of evaluating the molecular etiology for isolated, rapidly progressive infantile hepatic failure. (HEPATOLOGY 2007.)

Pathogenic mitochondrial DNA mutations in protein‐coding genes

More than 200 disease‐related mitochondrial DNA (mtDNA) point mutations have been reported in the Mitomap (http://www.mitomap.org) database. These mutations can be divided into two groups: mutations affecting mitochondrial protein synthesis, including mutations in tRNA and rRNA genes; and mutations in protein‐encoding genes (mRNAs). This review focuses on mutations in mitochondrial genes that encode proteins. These mutations are involved in a broad spectrum of human diseases, including a variety of multisystem disorders as well as more tissue‐specific diseases such as isolated myopathy and Leber hereditary optic neuropathy (LHON). Because the mitochondrial genome contains a large number of apparently neutral polymorphisms that have little pathogenic significance, along with secondary homoplasmic mutations that do not have primary disease‐causing effect, the pathogenic role of all newly discovered mutations must be rigorously established. A scoring system has been applied to evaluate the pathogenicity of the mutations in mtDNA protein‐encoding genes and to review the predominant clinical features and the molecular characteristics of mutations in each mtDNA‐encoded respiratory chain complex. Muscle Nerve, 2007

Quantitative Evaluation of the Mitochondrial DNA Depletion Syndrome

BACKGROUND The mitochondrial DNA (mtDNA) depletion syndromes (MDDSs) are autosomal recessive disorders characterized by a reduction in cellular mtDNA content. Mutations in at least 9 genes [POLG, polymerase (DNA directed), gamma; DGUOK, deoxyguanosine kinase; TK2, thymidine kinase, mitochondrial; TYMP, thymidine phosphorylase; MPV17, MpV17 mitochondrial inner membrane protein; SUCLA2, succinate-CoA ligase, ADP-forming, beta subunit; SUCLG1, succinate-CoA ligase, alpha subunit; RRM2B, RRM2B, ribonucleotide reductase M2 B (TP53 inducible); and C10orf2, chromosome 10 open reading frame 2 (also known as TWINKLE)] have been reported to cause mtDNA depletion. In the clinical setting, a simple method to quantify mtDNA depletion would be useful before undertaking gene sequence analysis. METHODS Real-time quantitative PCR (qPCR) was used to measure the mtDNA content in blood, muscle, and liver samples and in skin fibroblast cultures from individuals suspected of mitochondrial disorders, with or without deleterious mutations in genes responsible for MDDS. RESULTS The mtDNA content was quantified in 776 tissue samples (blood, n = 341; muscle, n = 325; liver, n = 63; skin fibroblasts, n = 47) from control individuals. mtDNA content increased with age in muscle tissue, decreased with age in blood samples, and appeared to be unaffected by age in liver samples. In 165 samples (blood, n = 122; muscle, n = 21; liver, n = 15; skin fibroblasts, n = 7) from patients with molecularly proven MDDSs, severe mtDNA depletion was detected in liver and muscle tissue with high specificity and sensitivity. Blood samples were specific but not sensitive for detecting mtDNA depletion, and skin fibroblasts were not valuable for evaluating mtDNA depletion. Mutations in the POLG, RRM2B, and MPV17 genes were prospectively identified in 1 blood, 1 liver, and 3 muscle samples. CONCLUSIONS Muscle and liver tissues, but not blood or skin fibroblasts, are potentially useful for rapid screening for mtDNA depletion with real-time qPCR.

Yield of mtDNA mutation analysis in 2,000 patients

The multiplex polymerase chain reaction-allele specific oligonucleotides (PCR/ASO) dot blot hybridization method was used to detect 44 mitochondrial DNA point mutations in 2,000 patients suspected as having mitochondrial DNA disorders. These point mutations are classified into four categories. Category I consists of primary disease-causing, heteroplasmic point mutations. Homoplasmic nucleotide substitutions that have been reported to be possibly disease associated are in Category II. Homoplasmic nucleotide substitutions that are thought to be benign polymorphism are included in category III. The novel nucleotide substitutions recently discovered in our laboratory by single strand conformation polymorphism analysis are in category IV. Frequencies of these 44 nucleotide substitutions in 2,000 patients and 262 control individuals were studied. The results indicated that analysis of 12 recurrent disease-causing point mutations in category I identified 5.4% of the patients suspected as having mitochondrial DNA disorders. Since the mitochondrial disorders are a group of complex, heterogeneous, and multisystemic diseases, it is often difficult to confirm clinical diagnosis without molecular studies. Thus, the multiplex PCR/ASO method is an effective approach for initial screening of mtDNA mutations in patients suspected as having mitochondrial DNA disorders.