Lorena Gómez-García

Chronic Helminth Infection Induces Alternatively Activated Macrophages Expressing High Levels of CCR5 with Low Interleukin-12 Production and Th2-Biasing Ability

ABSTRACT Helminth infections induce Th2-type biased immune responses. Although the mechanisms involved in this phenomenon are not yet clearly defined, antigen-presenting cells (APC) could play an important role in this process. Here, we have used peritoneal macrophages (F4/80+) recruited at different times after challenge with Taenia crassiceps as APC and tested their ability to regulate Th1/Th2 differentiation. Macrophages from acute infections produced high levels of interleukin-12 (IL-12) and nitric oxide (NO), paralleled with low levels of IL-6 and prostaglandin E2 (PGE2) and with the ability to induce strong antigen-specific CD4+ T-cell proliferation in response to nonrelated antigens. In contrast, macrophages from chronic infections produced higher levels of IL-6 and PGE2 and had suppressed production of IL-12 and NO, associated with a poor ability to induce antigen-specific proliferation in CD4+ T cells. Failure to induce proliferation was not due to a deficient expression of accessory molecules, since major histocompatibility complex class II, CD40, and B7-2 were up-regulated, together with CD23 and CCR5 as infection progressed. These macrophages from chronic infections were able to bias CD4+ T cells to produce IL-4 but not gamma interferon (IFN-γ), contrary to macrophages from acute infections. Blockade of B7-2 and IL-6 and inhibition of PGE2 failed to restore the proliferative response in CD4+ T cells. Furthermore, studies using STAT6−/− mice revealed that STAT6-mediated signaling was essential for the expansion of these alternatively activated macrophages. These data demonstrate that helminth infections can induce different macrophage populations that have Th2-biasing properties.

Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection

ABSTRACT Macrophage migration inhibitory factor (MIF) is a proinflammatory cytokine that is involved in the host defense against several pathogens. Here we used MIF−/− mice to determine the role of endogenous MIF in the regulation of the host immune response against Trypanosoma cruzi infection. MIF−/− mice displayed high levels of blood and tissue parasitemia, developed severe heart and skeletal muscle immunopathology, and succumbed to T. cruzi infection faster than MIF+/+ mice. The enhanced susceptibility of MIF−/− mice to T. cruzi was associated with reduced levels of proinflammatory cytokines, such as tumor necrosis factor alpha, interleukin-12 (IL-12), IL-18, gamma interferon (IFN-γ), and IL-1β, in their sera and reduced production of IL-12, IFN-γ, and IL-4 by spleen cells during the early phase of infection. At all time points, antigen-stimulated splenocytes from MIF+/+ and MIF−/− mice produced comparable levels of IL-10. MIF−/− mice also produced significantly less Th1-associated antigen-specific immunoglobulin G2a (IgG2a) throughout the infection, but both groups produced comparable levels of Th2-associated IgG1. Lastly, inflamed hearts from T. cruzi-infected MIF−/− mice expressed increased transcripts for IFN-γ, but fewer for IL-12 p35, IL-12 p40, IL-23, and inducible nitric oxide synthase, compared to MIF+/+ mice. Taken together, our findings show that MIF plays a role in controlling acute T. cruzi infection.

Intact glycans from cestode antigens are involved in innate activation of myeloid suppressor cells

During helminthic infections, strong Th2 type‐biased responses concomitant with impaired cell‐proliferative responses to parasitic and unrelated antigens are major immunological hallmarks. Parasite glycan structures have been proposed to play a role in modulating these responses. To understand early events related to immune modulation during cestode infection, we have examined the role of intact glycans of antigens from Taenia crassiceps in the recruitment of innate cells. Soluble antigens from this cestode contained higher levels of carbohydrates than proteins. Intraperitoneal injection of the antigens rapidly recruited a cell population expressing F4/80+/Gr‐1+surface markers, which adoptively suppressed naïve T‐cell proliferation in vitro in response to anti‐CD3/CD28 MAb stimulation in a cell‐contact dependent manner. Soluble antigens with altered glycans by treatment with sodium periodate significantly reduced the recruitment of F4/80+/Gr1+cells, concomitantly their suppressive activity was abrogated, indicating that glycans have a role in the early activation of these suppressor cells. Using C3H/HeJ and STAT6‐KO mice, we found that expansion and suppressive activity of F4/80+Gr1+cells induced by T. crassiceps intact antigens was TLR4 and Th2‐type cytokine independent. Together with previous studies on nematode and trematode parasites, our data support the hypothesis that glycans can be involved on a similar pathway in the immunoregulation by helminths.

Impaired pro-inflammatory cytokine production and increased Th2-biasing ability of dendritic cells exposed to Taenia excreted/secreted antigens: A critical role for carbohydrates but not for STAT6 signaling.

In cysticercosis, a parasitic disease caused by cestodes, the details of early interactions between parasite antigens and innate cells from the host are not well understood. In this study, the role of cestode-conditioned dendritic cells (DCs) in priming Th1 versus Th2 responses to bystander antigen was examined by using CD11c(+) DCs as antigen-presenting cells and naive CD4(+) DO11.10 lymphocytes specific to ovalbumin (OVA) as responding cells. No conventional maturation was induced in DCs exposed to Taenia crassiceps excreted/secreted antigens (TcES). The ability of TcES to affect Toll-like receptor (TLR)-mediated maturation and the pro-inflammatory response was analyzed by co-pulsing DCs with TcES and TLR ligands. DCs exposed to TcES blocked TLR4, TLR9 and Toxoplasma soluble antigen-induced phenotypic maturation. TcES-exposed DCs also blocked secretion of pro-inflammatory cytokines and alloreactive T cell proliferation, while preserving IL-10 production. DCs pulsed with TcES+OVA suppressed IFN-gamma, whereas they induced greater IL-4 production by CD4(+) DO11.10 cells. TcES with chemically-altered glycans failed to modulate TLR-mediated activation of DCs and their Th1-inhibitng ability, which was STAT6-independent. Our results reflect the capacity of TcES glyco-antigens to modulate Th1-type and inflammatory responses mediated through DC activation.

Carbohydrate components of Taenia crassiceps metacestodes display Th2-adjuvant and anti-inflammatory properties when co-injected with bystander antigen

Common helminth infections promote Th2-skewed immune responses in their hosts. We have studied the role of intact carbohydrate structures on Taenia crassiceps compounds in the induction of biased type 2 and anti-inflammatory immune responses on peptide-stimulated T cells by using DO11.10 transgenic (OVA Tg) mice. While OVA Tg mice co-injected with OVA peptide 323–339 (OVA323–339) plus intact Taenia soluble antigens (iTSA) displayed significantly higher titers of OVA-specific IgG1 and total IgE, low amounts of these antibodies were detectable in sera from OVA Tg mice co-injected with OVA323–339 plus periodate-carbohydrate altered TSA (paTSA). Spleen cells from OVA Tg mice failed to efficiently produce OVA-specific IFN-γ but displayed higher IL-4, IL-5 and IL-10 production when they received OVA323–339 plus iTSA, compared with OVA Tg mice similarly co-injected with OVA323–339 plus paTSA. Moreover, after in vivo stimulation with OVA323–339 plus iTSA, spleen cells did show elevated mRNA transcripts for Arginase 1, Ym1, IL-4, IL-10, TGF-β, and Mannose Receptor (MR) genes, all them associated with Th2-type and anti-inflammatory responses. Similar results were obtained using TLR4 mutant mice. Together these findings suggest that carbohydrate components in TSA are involved in modulating immune responses to bystander antigens and that do not signal via TLR4.

Modulation of Dendritic Cell Responses by Parasites: A Common Strategy to Survive

Parasitic infections are one of the most important causes of morbidity and mortality in our planet and the immune responses triggered by these organisms are critical to determine their outcome. Dendritic cells are key elements for the development of immunity against parasites; they control the responses required to eliminate these pathogens while maintaining host homeostasis. However, there is evidence showing that parasites can influence and regulate dendritic cell function in order to promote a more permissive environment for their survival. In this review we will focus on the strategies protozoan and helminth parasites have developed to interfere with dendritic cell activities as well as in the possible mechanisms involved.

Interferon-Gamma Increases the Ratio of Matrix Metalloproteinase-9/Tissue Inhibitor of Metalloproteinase-1 in Peripheral Monocytes from Patients with Coronary Artery Disease

Acute coronary syndromes (ACS) may be triggered by acute infections. Systemic production of interferon gamma (IFN-γ) is induced during infection and regulates the production of matrix metalloproteinases (MMPs) and their inhibitors (TIMPs), both important in plaque stability. This study evaluates the effect of IFN-γ on the MMPs/TIMP-1 ratio in cultured monocytes from 30 patients with stable coronary artery disease (CAD), 30 with unstable angina (UA) or non-ST-segment elevation myocardial infarction (NSTEMI), and 30 healthy blood donors. Supernatant concentrations of MMP-1, -2, -9, and TIMP-1 were measured by enzyme-linked immunoassays. Basal concentration of MMP-1 and TIMP-1 was similar between groups, while MMP-2 was higher in healthy individuals and MMP-9 in patients with UA/NSTEMI. Upon IFN-γ stimulation, MMP-9 secretion increased in all groups, while TIMP-1 decreased only in patients with CAD, which in turn result in a strikingly elevation in their mean MMP-9/TIMP-1 ratio. MMP-1/TIMP-1 and MMP-2/TIMP-1 ratios were <1.0 in basal conditions and after stimulation in all groups. Our results suggest that nonstimulated monocytes from patients with stable CAD show a similar behavior than those from healthy individuals. However, stimulation with IFN-γ induces an increase on the MMP-9/TIMP-1 ratio as high as that found in patients with ACS. Thus, it may bring biological plausibility to the association between acute infections and the development of ACS.

Mouse macrophage galactose-type lectin (mMGL) is critical for host resistance against Trypanosoma cruzi infection.

The C-type lectin receptor mMGL is expressed exclusively by myeloid antigen presenting cells (APC) such as dendritic cells (DC) and macrophages (Mφ), and it mediates binding to glycoproteins carrying terminal galactose and α- or β-N-acetylgalactosamine (Gal/GalNAc) residues. Trypanosoma cruzi (T. cruzi) expresses large amounts of mucin (TcMUC)-like glycoproteins. Here, we show by lectin-blot that galactose moieties are also expressed on the surface of T. cruzi. Male mMGL knockout (-/-) and wild-type (WT) C57BL/6 mice were infected intraperitoneally with 104 T. cruzi trypomastigotes (Queretaro strain). Following T. cruzi infection, mMGL-/- mice developed higher parasitemia and higher mortality rates compared with WT mice. Although hearts from T. cruzi-infected WT mice presented few amastigote nests, mMGL-/- mice displayed higher numbers of amastigote nests. Compared with WT, Mφ from mMGL-/- mice had low production of nitric oxide (NO), interleukin (IL)-12 and tumor necrosis factor (TNF)-α in response to soluble T. cruzi antigens (TcAg). Interestingly, upon in vitro T. cruzi infection, mMGL-/- Mφ expressed lower levels of MHC-II and TLR-4 and harbored higher numbers of parasites, even when mMGL-/- Mφ were previously primed with IFN-γ or LPS/IFN-γ. These data suggest that mMGL plays an important role during T. cruzi infection, is required for optimal Mφ activation, and may synergize with TLR-4-induced pathways to produce TNF-α, IL-1β and NO during the early phase of infection.

The macrophage galactose-type lectin-1 (MGL1) recognizes Taenia crassiceps antigens, triggers intracellular signaling, and is critical for resistance to this infection.

C-type lectins are multifunctional sugar-binding molecules expressed on dendritic cells (DCs) and macrophages that internalize antigens for processing and presentation. Macrophage galactose-type lectin 1 (MGL1) recognizes glycoconjugates expressing Lewis X structures which contain galactose residues, and it is selectively expressed on immature DCs and macrophages. Helminth parasites contain large amounts of glycosylated components, which play a role in the immune regulation induced by such infections. Macrophages from MGL1−/− mice showed less binding ability toward parasite antigens than their wild-type (WT) counterparts. Exposure of WT macrophages to T. crassiceps antigens triggered tyrosine phosphorylation signaling activity, which was diminished in MGL1−/− macrophages. Following T. crassiceps infection, MGL1−/− mice failed to produce significant levels of inflammatory cytokines early in the infection compared to WT mice. In contrast, MGL1−/− mice developed a Th2-dominant immune response that was associated with significantly higher parasite loads, whereas WT mice were resistant. Flow cytometry and RT-PCR analyses showed overexpression of the mannose receptors, IL-4Rα, PDL2, arginase-1, Ym1, and RELM-α on MGL1−/− macrophages. These studies indicate that MGL1 is involved in T. crassiceps recognition and subsequent innate immune activation and resistance.

Reduced numbers of circulating CD28‐negative CD4+ cells in patients with rheumatoid arthritis chronically treated with abatacept

Dear Editor, Rheumatoid arthritis (RA) is a chronic, autoimmune disorder characterized by premature immunosenescence. This includes increased numbers of circulating CD4+ T cells lacking CD28 expression, a key receptor for activating second signals delivered by antigenpresenting cells. Despite the role of CD28 to ensure appropriate activation, CD4+CD28 cells from RA patients remain functionally active and have been associated with severity of disease, presence of extra-articular manifestations and early atherosclerotic changes. Abatacept (CTLA-4Ig) is a T cell costimulation blocker demonstrated to be useful in the treatment of RA. After 48 weeks therapy, abatacept restores the expression of CD28 in CD4+ cells in parallel with clinical response, suggesting an active role for these cells. Nevertheless, whether the number of circulating CD4+CD28 cells remains reduced during long-term therapy, or it is a transient phenomenon, is unclear. Thus, our aimwas to investigate the number of circulating CD4+CD28 T cells in patients with RA under long-term therapy with abatacept. The present study was conducted in a single-center, outpatient rheumatology clinic. Patients with longlasting RA meeting the 1987 American College of Rheumatology classification criteria receiving abatacept for > 5 years with adequate clinical response were eligible. Also, disease activity-matched RA patients on successful therapy with disease modifying antirheumatic drugs (DMARDs) for > 5 years who have never received biological agents were included. Ten young, healthy individuals (seven female, median age 31 years) were included as reference. This protocol was approved by the local ethics committee and conducted in accordance with the Declaration of Helsinki. An informed consent was obtained from each participant. Demographics were obtained from medical charts. Examinations were performed by a rheumatologist (CR-A) blinded to laboratory results. Disease activity was assessed by the Disease Activity Score 28 – C-reactive protein (DAS28-CRP[3]) index. Peripheral blood mononuclear cells (PBMC) were isolated by density gradient and expression of surface markers was assessed by color flow-cytometry in a FACSCalibur (BD Biosciences, San Jose, CA, USA) using monoclonal antibodies against CD4 and CD28 molecules and conjugated with phycoerythrin and allophycocyanin, respectively (BioLegend, San Diego, CA, USA). Transcript levels were measured in PBMC by reverse transcription quantitative polymerase chain reaction (RT-qPCR), using the primers: TNF (NM_000594; forward-CAGCCTCTTCTCCTTCCTGA; reverse-GCCAGAGGGCTGATTAGAGA), NFjΒ1 (NM_0 01165412; forwardACCCTGACCTTGCCTATTT; reverse AGCTCTTTTTCCCGATCTCC) and GADPH (NM_0020 46.3; forward-AGCCACATCGCTCAGACAC; reverse GC CCAATACGACCAAATCC) and universal hydrolysis probes (Roche Diagnostics, Indianapolis, IN, USA). Serum levels of interferon gamma (IFN-c), interleukin (IL)-17, IL-1b, and IL-6 were tested by enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Minneapolis, MN, USA), while high-sensitivity CRP was measured by nephelometry (Beckman Coulter, Fullerton, CA, USA). All experiments were performed in accordance with the manufacturers’ instructions. Discrete variables are expressed as percentages and differences calculated by v or Fisher’s exact tests, while continuous variables are described in medians (minimum to maximum range) and compared by Kruskall-Wallis (Dunn’s multiple comparison test) or Mann-Whitney tests as appropriate. P < 0.05 was set for significance and analyses were performed in GraphPad Prism 4.02 (GraphPad Inc, San Diego, CA, USA) software. The main data of participants are described in Table 1. As noted, patients receiving abatacept had less use of antimalarials (33% vs. 87%; P = 0.04). The abatacept group showed a trend for higher serum CRP (10.4, 0.8–116 vs. 3.5, 0.7–14.8 mg/L; P = ns) even when total disease activity score was similar between RA groups (DAS28-CRP[3] index 3.6, 2.1–5.5 vs. 3.5,