Lucy R. Stewart

Maize Lethal Necrosis (MLN), an Emerging Threat to Maize-Based Food Security in Sub-Saharan Africa

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tons valued at

A Mutation in the Lettuce Infectious Yellows Virus Minor Coat Protein Disrupts Whitefly Transmission but Not In Planta Systemic Movement

52 million in Kenya alone. In eastern Africa, MLN was found to result from coinfection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management strategies, including identification of MLN-tolerant maize germplasm. We discuss recent progress, identify major issues requiring further research, and discuss the possible next steps for effective management of MLN.

Agroinoculation of the Crinivirus, Lettuce infectious yellows virus, for systemic plant infection

ABSTRACT The Lettuce infectious yellows virus (LIYV) RNA 2 mutant p1-5b was previously isolated from Bemisia tabaci-transmitted virus maintained in Chenopodium murale plants. p1-5b RNA 2 contains a single-nucleotide deletion in the minor coat protein (CPm) open reading frame (ORF) that is predicted to result in a frameshift and premature termination of the protein. Using the recently developed agroinoculation system for LIYV, we tested RNA 2 containing the p1-5b CPm mutant genotype (agro-pR6-5b) in Nicotiana benthamiana plants. We showed that plant infection triggered by agro-pR6-5b spread systemically and resulted in the formation of virions similar to those produced in p1-5b-inoculated protoplasts. However, virions derived from these mutant CPm genotypes were not transmitted by whiteflies, even though virion concentrations were above the typical transmission thresholds. In contrast, and as demonstrated for the first time, an engineered restoration mutant (agro-pR6-5bM1) was capable of both systemic movement in plants and whitefly transmission. These results provide strong molecular evidence that the full-length LIYV-encoded CPm is dispensable for systemic plant movement but is required for whitefly transmission.

Lettuce infectious yellows virus (LIYV) RNA 1-encoded P34 is an RNA-binding protein and exhibits perinuclear localization.

Lettuce infectious yellows virus (LIYV) is phloem-limited, non-mechanically transmissible, and is transmitted to plants only by Bemisia tabaci. Here, we developed agroinoculation to deliver LIYV to plants thereby obviating the need for B. tabaci. Agroinfiltration of RNA 1 containing a green fluorescent protein gene into Nicotiana benthamiana leaves resulted in subliminal infections, as judged by green fluorescence. Agroinfiltration of LIYV wild-type RNA 1 and 2 constructs resulted in systemic infections in N. benthamiana plants and typical LIYV symptoms. In addition, partially purified LIYV virions from agroinoculated N. benthamiana plants were successfully acquired via membrane-feeding and transmitted to lettuce plants by B. tabaci. Agroinoculation coupled with targeted mutagenesis technologies will greatly enhance LIYV reverse genetics studies to characterize LIYV gene functions in planta for processes such as virus replication, recombination, trafficking, symptom elicitation and virus-vector interactions.

Complete sequence and development of a full-length infectious clone of an Ohio isolate of Maize dwarf mosaic virus (MDMV).

The Crinivirus, Lettuce infectious yellows virus (LIYV) has a bipartite, positive-sense ssRNA genome. LIYV RNA 1 encodes replication-associated proteins while RNA 2 encodes proteins needed for other aspects of the LIYV life cycle. LIYV RNA 1 ORF 2 encodes P34, a trans enhancer for RNA 2 accumulation. Here we show that P34 is a sequence non-specific ssRNA-binding protein in vitro. P34 binds ssRNA in a cooperative manner, and the C-terminal region contains the RNA-binding domain. Topology predictions suggest that P34 is a membrane-associated protein and the C-terminal region is exposed outside of the membrane. Furthermore, fusions of P34 to GFP localized to the perinuclear region of transfected protoplasts, and colocalized with an ER-specific dye. This localization was of interest since LIYV RNA 1 replication (with or without P34 protein) induced strong ER rearrangement to the perinuclear region. Together, these data provide insight into LIYV replication and possible functions of P34.

Lettuce infectious yellows virus-encoded P26 induces plasmalemma deposit cytopathology

Maize dwarf mosaic virus (MDMV) is an important and widespread aphid-transmitted virus of maize. It is a member of the genus Potyvirus in the family Potyviridae with a monopartite (+) ssRNA genome. Here we report the complete genome sequence and construction and testing of infectious clones of an Ohio isolate of MDMV. Full-length MDMV cDNA was cloned into the vector pSPORT. Full-length cDNA PCR-amplified from the vector constructs were used as template for in vitro transcription, and transcripts were inoculated to maize seeds by vascular puncture inoculation. Plants inoculated by this procedure showed symptoms typical of MDMV infection, and infection was confirmed by RT-PCR and mechanical transmission to new plants.

Viruses in maize and Johnsongrass in southern Ohio.

Lettuce infectious yellows virus (LIYV) encodes a 26 kDa protein (P26) previously shown to associate with plasmalemma deposits (PLDs), unique LIYV-induced cytopathologies located at the plasmalemma over plasmodesmata pit fields in companion cells and phloem parenchyma. To further characterize the relationship of P26 and PLDs, we assessed localization and cytopathology induction of P26 expressed from either LIYV or a heterologous Tobacco mosaic virus (TMV) vector using green fluorescent protein (GFP) fusions, immunofluorescence microscopy, biochemical fractionation, and transmission electron microscopy (TEM). TEM analyses demonstrated that P26 not only associated with, but induced formation of PLDs in the absence of other LIYV proteins. Interestingly, PLDs induced by P26-expressing TMV were no longer confined to phloem cells. Putative P26 orthologs from two other members of the genus Crinivirus which do not induce conspicuous PLDs exhibited fractionation properties similar to LIYV P26 but were not associated with any PLD-like cytopathology.

Reduction in fecundity and shifts in cellular processes by a native virus on an invasive insect

The two major U.S. maize viruses, Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV), emerged in southern Ohio and surrounding regions in the 1960s and caused significant losses. Planting resistant varieties and changing cultural practices has dramatically reduced virus impact in subsequent decades. Current information on the distribution, diversity, and impact of known and potential U.S. maize disease-causing viruses is lacking. To assess the current reservoir of viruses present at the sites of past disease emergence, we used a combination of serological testing and next-generation RNA sequencing approaches. Here, we report enzyme-linked immunosorbent assay and RNA-Seq data from samples collected over 2 years to assess the presence of viruses in cultivated maize and an important weedy reservoir, Johnsongrass (Sorghum halepense). Results revealed a persistent reservoir of MDMV and two strains of MCDV in Ohio Johnsongrass. We identified sequences of several other grass-infecting viruses and confirmed the presence of Wheat mosaic virus in Ohio maize. Together, these results provide important data for managing virus disease in field corn and sweet corn maize crops, and identifying potential future virus threats.

Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields

Pathogens and their vectors have coevolutionary histories that are intricately intertwined with their ecologies, environments, and genetic interactions. The soybean aphid, Aphis glycines, is native to East Asia but has quickly become one of the most important aphid pests in soybean-growing regions of North America. In this study, we used bioassays to examine the effects of feeding on soybean infected with a virus it vectors (Soybean mosaic virus [SMV]) and a virus it does not vector (Bean pod mottle virus [BPMV]) have on A. glycines survival and fecundity. The genetic underpinnings of the observed changes in fitness phenotype were explored using RNA-Seq. Aphids fed on SMV-infected soybean had transcriptome and fitness profiles that were similar to that of aphids fed on healthy control plants. Strikingly, a significant reduction in fecundity was seen in aphids fed on BPMV-infected soybean, concurrent with a large and persistent downregulation of A. glycines transcripts involved in regular cellular activities. Although molecular signatures suggested a small regulatory RNA pathway defense response was repressed in aphids feeding on infected plants, BPMV did not appear to be replicating in the vector. These results suggest that incompatibilities with BPMV or the effects of BPMV infection on soybean caused A. glycines to allot available energy resources to survival rather than reproduction and other core cellular processes. Ultimately, the detrimental impacts to A. glycines may reflect the short tritrophic evolutionary histories between the insect, plant, and virus.

Johnsongrass mosaic virus Contributes to Maize Lethal Necrosis in East Africa

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.