Luigiana Luciano

Health-related quality of life in chronic myeloid leukemia patients receiving long-term therapy with imatinib compared with the general population

The main objective of this study was to investigate whether patients with chronic myeloid leukemia (CML) in treatment with long-term therapy imatinib have a different health-related quality-of-life (HRQOL) profile compared with the general population. In total, 448 CML patients were enrolled, and the SF-36 Health Survey was used to compare generic HRQOL profiles. Symptoms were also assessed. HRQOL comparisons were adjusted for key possible confounders. The median age of patients was 57 years and the median time of imatinib treatment was 5 years (range 3-9 years). The largest HRQOL differences were found in younger patients. In particular, patients aged between 18 and 39 years had marked impairments in role limitations because of physical and emotional problems, respectively: -22.6 (P < .001), -22.3 (P < .001). Patients with CML age 60 or older had a HRQOL profile very similar to that reported by the general population. Women had a worse profile than men when each were compared with their peers in the general population. Fatigue was the most frequently reported symptom. The HRQOL of CML patients is comparable with that of population norms in many areas, however, younger and female patients seem to report the major limitations.

Chronic fatigue is the most important factor limiting health-related quality of life of chronic myeloid leukemia patients treated with imatinib

Health-related quality of life (HRQOL) is an important goal of therapy for chronic myeloid leukemia (CML) patients treated with current molecular-targeted therapies. The main objective of this study was to investigate factors associated with long-term HRQOL outcomes of CML patients receiving imatinib. Analysis was performed on 422 CML patients recruited in an observational multicenter study. HRQOL was assessed with the Medical Outcomes Study 36-Item Short-Form Health Survey (SF-36). Key socio-demographic and clinical data were investigated for their association with HRQOL outcomes. Chronic fatigue and social support were also investigated. Univariate and multivariate linear regression analyses were used to identify independent factors associated with HRQOL outcomes. Fatigue was the only variable showing an independent and consistent association across all physical and mental HRQOL outcomes (P<0.01). Differences between patients reporting low versus high fatigue levels were more than eight and seven times the magnitude of a clinically meaningful difference, respectively, for the role physical (Δ=70 points) and emotional scale (Δ=63 points) of the SF-36. Fatigue did not occur as an isolated symptom and was most highly correlated with musculoskeletal pain (r=0.511; P⩽0.001) and muscular cramps (r=0.448; P⩽0.001). Chronic fatigue is the major factor limiting HRQOL of CML patients receiving imatinib.

Effects of cyclosporine on hematopoietic and immune functions in patients with hypoplastic myelodysplasia: In vitro and in vivo studies

Immunosuppression may benefit some patients with hypoplastic myelodysplasia (HMDS) and refractory anemia (RA), but its mechanism of action is still obscure.

Charlson comorbidity index and adult comorbidity evaluation-27 scores might predict treatment compliance and development of pleural effusions in elderly patients with chronic myeloid leukemia treated with second-line dasatinib

Background Comorbidities may affect survival and choice of treatment among cancer patients. In fact, comorbidities have been identified as significant determinants of response to therapy in older patients with acute myeloid leukemia, breast cancer, head and neck cancer, and lung cancer. The Charlson comorbidity index and adult comorbidity evaluation-27 are lists of comorbidities with a weight assigned from 1 to 6 for the former and from 0 to 3 for the latter score, derived from relative risk estimates of a proportional hazard regression model using clinical data. Design and Methods We retrospectively evaluated the Charlson index and adult comorbidity evaluation-27 score in a cohort of 125 elderly (> 60 years) patients with chronic phase chronic myeloid leukemia who received dasatinib after showing resistance or intolerance to imatinib with the aim of establishing associations between comorbidities and the development of pleural effusions or compliance with the drug treatment. Results We found a significant association between the Charlson index as well as the adult comorbidity evaluation-27 score and the rate of drug reduction or suspension: with regards to the Charlson index, 49% of score 0 patients had a dose reduction compared to 63% of patients with score 1, 74% of those with score 2 and 100% of patients with score 3–5 (P=0.03); with regards to the adult comorbidity evaluation-27 score, 45% of patients had score 0–1 and 69% of patients with score 2–3 had a dose reduction. Of the 65 patients with Charlson score 0, 29% had at least one suspension of treatment (79% for hematologic and 21% for non-hematologic toxicity), compared to 46% of patients with score 1 (37% for hematologic and 69% for non-hematologic toxicity), 58% of patients with score 2 (36% for hematologic and 64% for non-hematologic toxicity) and 100% of patients with score 3 or 4 (all patients for both types of toxicity). High adult comorbidity index-27 scores identified patients at high risk of grade 3/4 hematologic toxicity. Forty-one patients (32.8%) experienced pleural effusion during treatment: the highest scores for both indices were associated with an increased risk of pleural effusions. Conclusions In elderly patients with chronic myeloid leukemia treated with dasatinib, the rate of drug reduction or suspension and the incidence of pleural effusions seem to be associated with the presence of comorbidities: stratification according to the Charlson index and adult comorbidity evaluation-27 score before dasatinib therapy may enable the identification of patients at risk of major toxicities.

Incidence, risk factors and management of pleural effusions during dasatinib treatment in unselected elderly patients with chronic myelogenous leukaemia

To assess the most important features and clinical impact of pleural effusions, which are a common toxicity during dasatinib treatment and often impair its high efficacy, 172 unselected consecutive patients with chronic myelogenous leukaemia in chronic phase treated in 27 Italian centres, with dasatinib when aged >60 years for resistance/intolerance to imatinib, were examined. During treatment, 52/172 patients (30.2%) presented pleural effusion, which was grades 1–2 in 38 patients and grades 3–4 in 14 patients (8.1% of the entire cohort of patients), according to the WHO scale; in 14/52 patients (26.9%), there was a concomitant pericardial effusion. Pleural effusion was recurrent in 25/52 patients (48.0%). Median time from dasatinib to first pleural effusion was 11.0 months (interquartile range 3.6–18.6). Eleven patients (6.4%) required permanent dasatinib discontinuation. Only presence of concomitant pulmonary disease ( p = 0.035) and initial daily dose of dasatinib (140 mg vs 100 mg, p = 0.014) were significantly associated with pleural effusions. There were no differences among patients with or without pleural effusions as concerns response rates and overall survival. Pleural effusions were common in our unselected ‘real‐life’ population of elderly patients but were clinically manageable and did not seem to affect treatment results. Copyright

Long-lasting decrease of marrow and circulating long-term culture initiating cells after allogeneic bone marrow transplant

We investigated bone marrow (BM) and circulating (PB) hematopoietic progenitor cells in 37 normal donors and in 25 patients 1 to 8 years after successful allogeneic bone marrow transplant. At the time of testing, transplanted patients had normal blood counts and bone marrow cellularity. By flow cytometry, BM CD34+ cells were found to be three- to four-fold decreased in transplanted patients compared to normal donors, while the number of PB CD34+cells was the same as in normal donors. Using a methylcellulose colony assay, primary BM colony-forming cells (CFU-GM) were decreased 2.1-fold, whereas PB CFU-GM were only marginally decreased. In a long-term culture initiating cell (LTC-IC) assay, an eight-fold decrease of early progenitor cells was observed in the marrow of transplanted patients compared to normal donors, and a five-fold decrease was documented in peripheral blood. We found that the BM LTC-IC cell number correlated with concurrently determined BM CD34+ cells and committed progenitor cell number (measured as CFU-GM) and with PB LTC-IC number, but not with PB CFU-GM and CD34+ cells. We conclude that marrow and circulating early stem cell compartments, as measured by the LTC-IC assay, are greatly and permanently depressed following bone marrow transplant. The correlation between BM and PB LTC-IC indicates that the enumeration of circulating LTC-IC can be used as a measure of the stem cell compartment in the bone marrow after transplant. It seems that the deficiency of the most immature progenitor cells persists forever after successful bone marrow transplant; this means that a complete hematopoietic reconstitution can be sustained by a reduced stem cell pool.

Immune dysregulation and dyserythropoiesis in the myelodysplastic syndromes

The myelodysplastic syndromes (MDS) are clonal disorders characterised by ineffective haematopoiesis with high risk of leukaemia progression. The relevance of immune‐dysregulation for emergence, dominance and progression of dysplastic clones has been suggested, but valuable criteria to obtain insight into these connections are lacking. This study showed significant increase of CD8 lymphocytes and mature B cells in the bone marrow (BM) compared to peripheral blood (PB) of low risk MDS patients. Different BM levels of Regulatory T cells (Treg) identified two sub‐groups in these patients; only the sub‐group with lower Treg percentage showed BM recruitment of CD8 lymphocytes. Different levels of CD54 on BM CD8 cells revealed two sub‐groups of Intermediate‐1 (Int‐1) patients. The sub‐group with higher CD54 expression on BM CD8 showed high levels of this molecule also on CD4 cells. BM recruitment of CD8 lymphocytes in the low risk group and/or the presence of high CD54 expression on BM CD8 in Int‐1 patients were associated with more pronounced dyserythropoiesis and erythropoietin treatment. Our data shed light on the involvement of immune‐mediated mechanisms in Low and Int‐1 risk MDS patients and suggest that BM versus PB levels of immune effectors could represent useful criteria for a more homogeneous grouping of MDS patients.

All-trans-retinoic acid (ATRA) responsive skin relapses of acute promyelocytic leukaemia followed by ATRA-induced pseudotumour cerebri

A 30‐year‐old woman with acute promyelocytic leukaemia (APL) went into complete remission following idarubicin and cytarabine chemotherapy; 18 months later she developed repeated skin relapse, with no bone marrow involvement. DNA and RNA analysis of skin lesions revealed the presence of the PML/RARα hybrid gene, which was not detected at the same time in bone marrow. The skin relapses were successfully treated by all‐trans‐retinoic acid (ATRA) as single agent over 2 years. However, prolonged administration of ATRA caused pseudotumour cerebri, which disappeared upon drug withdrawal. The absence of the hybrid gene in the bone marrow by RT‐PCR analysis led to the patient being autografted.

Treatment of Philadelphia-Positive Chronic Myeloid Leukemia with Imatinib: Importance of a Stable Molecular Response

Purpose: The achievement of a major molecular response (MMolR) at 12 months is a surrogate marker of progression-free survival in chronic myeloid leukemia patients treated with imatinib. Experimental Design: We evaluated the prognostic value of the long-term evolution of the molecular response based on a retrospective analysis of 130 late chronic phase chronic myeloid leukemia patients who achieved a complete cytogenetic response (CCgR) with 400 mg/d imatinib and have now a median follow-up of 72 months (range, 48-77). Results: In 71 (55%) patients, molecular response was consistently major (stable MMolR); in 19 (15%) patients, molecular response was occasionally less than major (unstable MMolR); in 40 (30%) patients, MMolR was never achieved (never MMolR) during all the course of CCgR. Patients with stable MMolR had a longer CCgR duration and a significantly better progression-free survival compared with patients with absent or unstable MMolR. The achievement of a MMolR, if maintained continuously, conferred a marked long-term stability to the CCgR: patients with a stable MMolR have a significantly lower risk of losing the CCgR than patients with unstable and never MMolR (4% versus 21%, P = 0.03, and 4% versus 33%, P < 0.0001, respectively). Finally, if a MMolR is not maintained consistently, the risk of losing the CCgR is higher but not significantly than if it is never achieved (33% versus 21%, P = 0.5). Conclusions: These data confirm that achieving a MMolR is prognostically important but point out that the prognostic value of achieving a MMolR is greater if the response is confirmed and stable.

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with