Luiza Akria

Predicting infections in high‐risk patients with myelodysplastic syndrome/acute myeloid leukemia treated with azacitidine: Aretrospective multicenter study

Hypomethylating agents have become the standard therapy for patients with high‐risk myelodysplastic syndrome (MDS). In Israel, azacitidine (AZA) is routinely used. Yet, infectious complications are common during AZA therapy. The current study was aimed to evaluate the incidence and predisposing risk factors for infections in AZA‐treated patients. This retrospective study included patients treated with AZA in 18 Israeli medical institutions between 2008 and 2011. Data on 184 patients [157 high‐risk MDS and 27 acute myeloid leukemia (AML)], with a median age of 71.6 (range 29–92) were recorded. Overall, 153 infectious events were reported during 928 treatment cycles (16.5%) administered to 100 patients. One hundred fourteen, 114/153 (75%) events required hospitalization and 30 (19.6%) were fatal. In a univariate analysis, unfavorable cytogenetics, low neutrophil, hemoglobin (Hb) and platelet (PLT) counts were found to be associated with infections (24.4% vs. 12.9%, P < 0.0001; 27% vs. 13.5%, P < 0.0001; 20.4% vs. 11%, P < 0.0001 and 29.2% vs. 14.2%, P < 0.0001, respectively). In multivariate analysis, only low Hb level, low PLT count, and unfavorable cytogenetics remained significant. Prior to therapy, poor cytogenetics, PLT count below 20 × 109/L and neutrophil count below 0.5 × 109/L were predictive of the risk of infection during the first two cycles of therapy. In conclusion, patients with unfavorable cytogenetics, presenting with low neutrophil and PLT counts, are susceptible to infections. Evaluation of infection risk should be repeated prior to each cycle. Patients with poor cytogenetics in whom AZA is prescribed despite low PLT count are particularly at high risk for infections and infection prophylaxis may be considered. Am. J. Hematol. 88:130–134, 2013.

Rare coexistence of Rosai - Dorfman disease and nodal marginal zone lymphoma complicated by severe life-threatening autoimmune hemolytic anemia

Rosai – Dorfman disease (RDD), otherwise known as sinus histiocytosis with massive lymphadenopathy (SHML), is a rare macrophage-related histiocytic disorder of unknown etiology, dominated by histiocytic and lymphocytic infi ltration of enlarged lymph nodes [1]. Patients with RDD may rarely also have an associated malignant lymphoma, possibly involving diff erent anatomical sites and developing at diff erent time intervals. Until now only 22 cases of RDD in association with lymphomas have been reported in the world literature [2 – 18]. Th e concomitant occurrence of RDD and nodal marginal zone lymphoma is exceptionally rare, and we were able to fi nd only one documented case of this kind [17]. Here we report another rare case of nodal marginal zone lymphoma with coexistent RDD, which also was accompanied by life-threatening autoimmune hemolytic anemia. A previously healthy 50-year-old man was admitted to the intensive care unit with severe weakness and headache, palpitations, chest pain, nausea and vomiting. Th e symptoms began 5 days before admission and progressed rapidly. On admission to hospital, the patient was pale with sinus tachycardia and moderate splenomegaly, without palpable peripheral lymphadenopathy. Th e blood tests revealed very severe anemia with hemoglobin (Hb) 2.8 g/dL, mean corpuscular volume (MCV) 105 fL, reticulocytosis 16%, mild leukocytosis, with a white blood cell count (WBC) of 14 500, with normal diff erential count, neutrophils 57%, lymphocytes 23%, normal absolute lymphocyte count 3500 and normal platelet count 193 000. Th e blood chemistry revealed high levels of lactate dehydrogenase (LDH) 703 U/L (normal 125 – 243 U/L), with total bilirubin 2.6 mg/dL (normal 0.2 – 1.2) and indirect bilirubin 1.5 mg/dL (normal up to 0.7 mg/dL). Th e direct antiglobulin test was strongly positive (recorded as DAT ) for immunoglobulin G (IgG) and C3. Flow cytometry analysis from peripheral blood detected a monoclonal population of B lymphocytes (56%), positive for CD20, kappa light chain and FMC7. CD23 and CD38 were mildly positive (10% and 11%). Cells were negative for CD5, CD43, CD79b, CD11c, CD10, CD103 and CD25. Th e phenotype was compatible with a CD5 x03 B cell lymphoproliferative disease (LPD), other than CLL. Th e bone marrow biopsy revealed a markedly hypercellular bone marrow showing both a nodular and interstitial pattern of infi ltration by small intermediate size lymphocytes, which occupied up to 30% of the bone marrow cellular compartment. Th e immunohistochemical study revealed these cells to be strongly positive for CD20 and leukocyte common antigen (LCA). CD79a and CD10 were positive only in a few cells; CD23, CD43, BCL-1, BCL-6, DBA-44 and tartrate resistant acid phosphatase (TRAP) were all negative. Th e fi ndings were compatible with involvement by B-cell LPD, probably marginal zone lymphoma (MZL). Molecular analysis by polymerase chain reaction (PCR) from the bone marrow showed positive immunoglobulin heavy chain (IgH) rearrangement. A total body computed tomography (CT) scan showed abdominal lymphadenopathy up to 4 x04 3 cm (celiac, hepatic hilus and retroperitoneal nodes) and moderate spleno megaly (16.7 8 18.4 cm), with a negative fl uorodeoxyglucose positron emission tomography (FDG PET) scan, showing no pathological uptake. A lymph node biopsy was performed in order to establish a more accurate diagnosis of the LPD and the fi ndings described below were compatible with marginal zone lymphoma and, unexpectedly, also concomitant Rosai – Dorfman disease. Th e architecture of the lymph node was completely altered. Th ere was marked dilatation of medullary and cortical sinuses (Figure 1), containing large irregular mononuclear histiocytes with abundant pale vacuolated eosinophilic cytoplasm. Some of the histiocytes clearly had lymphocytes in their cytoplasm (emperipolesis) (Figure 2). L eu k L ym ph om a D ow nl oa de d fr om in fo rm ah ea lth ca re .c om b y M ic hi ga n U ni ve rs ity o n 10 /3 0/ 14

Bortezomib-induced peripheral neuropathy is related to altered levels of brain-derived neurotrophic factor in the peripheral blood of patients with multiple myeloma

Loss of nerve growth factor-mediated neuronal survival has recently been proposed as a candidate mechanism underlying bortezomib-induced peripheral neuropathy (BIPN) (Broyl et al, 2010). However the literature does not reveal any data from patients that can support this hypothesis. Brain-derived neurotrophic factor (BDNF) is a neuronal growth factor that is crucial for neuronal survival and repair (Hofer & Barde, 1988). We report on alterations in BDNF peripheral blood levels and the development of BIPN in patients with multiple myeloma (MM). Following approval of the Ethics Committee and obtaining patient’s informed consent, peripheral neuropathy was assessed and graded in 25 MM patients using the abbreviated version of the Total Neuropathy Score (TNS) tool (Argyriou et al, 2008). These patients were examined at diagnosis and after receiving four courses of a bortezomib-based regimen given intravenously either weekly or biweekly (Table I). Patients that developed TNS ≥ 2 during treatment were determined to have BIPN and three patients with TNS ≥ 2 at diagnosis were excluded from the study. At the time of neurological examination, a venous blood sample was obtained and soluble BDNF (sBDNF) level was determined by a commercial enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN, USA) in platelet-poor-plasma. One of our patients passed away after two courses of bortezomib. Eight of the remaining patients (36%) developed BIPN. We found lower levels of sBDNF in the plasma of patients that developed BIPN as compared to patients that did not develop BIPN [BDNF level standard deviation (SD) in BIPN 2 164 0 721 vs. 4 62 0 61 ng/ml in non-BIPN; P = 0 007; Fig 1A]. By analysing the difference between BDNF levels at diagnosis and after four courses of treatment of each patient, we demonstrated that sBDNF level was reduced in patients developing BIPN while it remained stable or even minimally elevated in patients that did not develop BIPN (difference in BDNF SD in BIPN 1 668 0 670 vs. 0 405 0 708 ng/ml in non-BIPN P = 0 02) (Fig 1B). Platelets are thought to be responsible for the homeostasis of BDNF in the blood as they take up, store and secrete BDNF (Fujimura et al, 2002). As we did not observe differences in the platelet counts of patients that developed BIPN compared to patients that did not develop BIPN (data not shown), we reasoned that decreased sBDNF levels in the plasma of patients with BIPN may result from lack of secretion of BDNF from the platelets. To test this hypothesis, we determined the content of BDNF in the platelets of patients that developed BIPN relative to those who did not develop BIPN by two different methods. First, platelets that were collected and stored in 20°C at the time of the patients’ examination were lysed and the BDNF immunoreactive band was determined by gel electrophoresis using specific rabbit polyclonal anti-human BDNF mAb (Abcam, Cambridge, MA, USA). Second, BDNF and the platelet activation marker CD62p were determined in freshly isolated platelets of patients with BIPN and patients without BIPN using flow cytometry. Briefly, 20 ll of platelet-rich-plasma from each patient was stained with phycoerythrin-cyanin 5 (PE-CY5) Anti human CD41a monclonal antobody (mAb) (Beckmann Coulter, Brea, CA, USA) and PE anti human CD62p mAb (Biolegends, San Diego, CA, USA) or fixed permeabilized (Invitrogen, Frederick, MD, USA) and stained with ATTO-488 Anti human proBDNF pAb (Alomone Labs Ltd., Jerusalem, Israel). The intensity of surface CD62p or intracellular BDNF signal was determined in 10 000 platelets. Analysis of BDNF in platelets by gel electrophoresis suggested that BDNF content was increased in platelets of patients who developed BIPN as compared to platelets of patients that did not (mean BDNF expression level post-treatment relative to pre-treatment SD in BIPN 4 33 1 15-fold vs. 1 67 0 57-fold in non-BIPN P = 0 02) (Fig 1C). Flow cytometric analysis confirmed the increase of BDNF content in platelets of patients with BIPN, as detected by higher intensity of proBDNF compared to platelets of patients without BIPN [mean fluorescence intensity (MFI) of BDNF SD in BIPN 43 12 6 04 vs. 18 267 10 162 ng/ml in non-BIPN P = 0 009]. As expected, the increased BDNF signal in platelets of patients with BIPN coincided with lower

A simple approximation for Busulfan dose adjustment in adult patients undergoing bone marrow transplantation

Busulfan is an alkylating agent used in preparative regimens before bone marrow transplantation (BMT). Busulfan concentrations in plasma, expressed as the area under the concentration–time curve (AUC), were reported to correlate with treatment outcome. Because busulfan is administered in 16 doses of 1 mg/kg every 6 hours for 4 days, the opportunities to “correct” the dose as a consequence of the measured AUC are limited to the 16-dosage protocol. In the present research busulfan pharmacokinetics were prospectively evaluated in 27 adult patients treated according to the above protocol by measuring the first, second, and fifth dose AUC. The pharmacokinetic analysis was based on a noncompartment model for extravascular absorption, but calculations according to a 1-compartment model gave similar results. A simple mathematical approximation allowed prediction of the AUC of the second dose from that of the first and the busulfan concentration at trough. Fifteen patients had the dose adjusted at the fourth dose to obtain an AUC within the “therapeutic window” of 950–1500 μM-min. This procedure was then validated by the measurement of the fifth dose AUC. It appears that this simple pocket calculator method allows a rapid evaluation of the need and the extent of dose adjustment and proved to be a valuable tool to improve busulfan administration in pre BMT treatment.

Modification of initial therapy in early and advanced Hodgkin lymphoma, based on interim PET/CT is beneficial: a prospective multicentre trial of 355 patients

This multicentre study evaluated 5‐year progression‐free (PFS) and overall survival (OS) in early and advanced Hodgkin lymphoma (HL), where therapy was individualized based on initial prognostic factors and positron emission tomography‐computed tomography performed after two cycles (PET‐2). Between September 2006 and August 2013, 359 patients aged 18–60 years, were recruited in nine Israeli centres. Early‐HL patients initially received ABVD (adriamycin, bleomycin, vinblastine, dacarbazine) ×2. Depending on initial unfavourable prognostic features, PET‐2‐positive patients received additional ABVD followed by involved‐site radiotherapy (ISRT). Patients with negative PET‐2 and favourable disease received ISRT or ABVD ×2; those with unfavourable disease received ABVD ×2 with ISRT or, alternatively, ABVD ×4. Advanced‐HL patients initially received ABVD ×2 or escalated BEACOPP (bleomycin, etoposide, adriamycin, cyclophosphamide, vincristine, procarbazine, prednisone; EB) ×2 based on their international prognostic score (≤2 or ≥3). PET‐2‐negative patients further received ABVD ×4; PET‐2‐positive patients received EB ×4 and ISRT to residual masses. With a median follow‐up of 55 (13–119) months, 5‐year PFS was 91% and 69% for PET‐2‐negative and positive early‐HL, respectively; 5‐year OS was 100% and 95%, respectively. For advanced‐HL, the PFS was 81% and 68%, respectively (P = 0·08); 5‐year OS was 98% and 91%, respectively. PET‐2 positivity is associated with inferior prognosis in early‐HL, even with additional ABVD and ISRT. Advanced‐HL patients benefit from therapy escalation following positive PET‐2. EB can be safely de‐escalated to ABVD in PET‐2‐negative patients.

Hairy cell leukemia-variant without typical morphology and with Near-tetraploid DNA Content

A 75-year-old male was referred to our medical center due to abdominal pain. Clinical record showed splenomegaly 4 years prior to his visit and a mild microcytic anemia during the last 2 years. Physical examination showed splenomegaly without lymphadenopathy. Complete blood count showed anemia (RBC 4.21 3 10/mL, Hg 10.3 g/DL, MCV: 76.5), normal leukocyte count 4.93 3 10/mL (with normal differential), and thrombocytopenia (107 3 10/mL). Bone marrow (BM) aspirate that was sent for flow cytometry showed lymphocyte clusters that accounted for 30% of the total nucleated cell component and Kappa restricted B cells that accounted for 30% of the total lymphocytes. DNA analysis that we performed showed near tetraploid DNA content (DI 5 1.95) coexpressing the B cell marker CD20. Further immuno-phenotyping of the B cells showed bright expression of CD45, positive expression of FMC7, CD22, CD23, CD79b, and CD200 and negative expression of CD5, CD10, and CD43. Detection of HCL-relevant antigens showed positive expression of CD11c and CD123, dim CD103 expression and negative expression of CD25. Staining with LAIR1(CD305) showed bright expression. BM biopsy was mild hyper-cellular with increased small to intermediate size lymphocytes showing diffuse interstitial pattern and minimal nodular pattern. CD45 was positive in 30% of cells, part of which was positive to CD20 and CD79a and part to CD3 and CD5. The percentage of leukemic cell out of the total hematopoietic cellularity in the bone marrow biopsy was 10%. TRAP immunoreactivity was inconclusive. Flow cytometry analysis of the peripheral blood (PB) showed the malignant B cells with incidence of 42.1% among the total lymphocyte component (901 leukemic cells/mL) and identical immuno-phenotype and aneuploidy as observed in the BM aspirate (Fig. 1a–d). A search for pathological cells in the blood smear showed medium to large size cells with prominent nucleolus and wide cytoplasm that lack visible hairy branches (Fig. 1g). Due to uncertain diagnosis, the extremely enlarged spleen (2.48 kg, 28 cm long as determined by ultrasound 2 month before splenectomy) was removed from the patient. Flow cytometry analysis of the spleen biopsy showed lymphocyte cluster that accounted for 85% of the total nucleated cell component and Kappa restricted B cells that accounted for 45% of the total lymphocytes. The B cells in the spleen showed immunophenotype and aneuploidy similar to the BM aspirate and the peripheral blood (PB) (Fig. 1e,f). Histological assessment of the spleen showed little and condensed white pulp with massive lymphocyte infiltration in the red pulp. The lymphocytes were medium size with irregular cell nuclei, partly folded with clumping chromatin; some of them with prominent nucleoli. The lymphocytes were positively stained with CD20, CD79a, PAX-5, CD23, and TRAP (Fig. 1h). Immunoreactivity to Annexin-1A, DAB44, BCL-6, MUM-1, CD10, CD5, and P53 were negative. Ki67 was positive in 30% of the lymphocytes and the larger atypical cells represented the greater fraction of the proliferating cells. Immunoreactivity to cMYC and BCL-1 were positive only in a few cells. Molecular analysis of the spleen biopsy showed negative t(11:14) translocation, wild type BRAF (exon 15 V600E) and MEK1/MAP2K1 were determined to be without mutation. An unbiased search for the clonal immunoglobulin heavy chain (IGH) gene rearrangement harbored by the tumor was performed. This analysis revealed the tumor IGH gene rearrangement to contain a 100% unmutated VH4-34 variable gene. Flow cytometry analysis of BM aspirate that was taken from the patient one month after splenectomy showed lymphocyte clusters that accounted for 26% of the total nucleated cell component and Kappa restricted B cells that accounted for 36% of the total lymphocytes. The malignant B cells showed similar immuno-phenotype to the cells at diagnosis and they were clearly recognized by their near-tetraploid peak. BM sample that was sent for cytogenetics showed no abnormality in the 19 cells in metaphase that were screened. Nevertheless, BM sample that was sent for FISH analysis detected cells with nuclear atypia that showed four signals for centromeres 2, 4, 8, 10, 15, and 17 as well as four MLL and four IGH signals. Analysis of centromere 9 showed three signals. By contrast, p53 was found to be with only 2 signals, suggesting a deletion of p53 in the atypical cells with the neartetraploid DNA. Sequencing of TP53 exons 4–9 showed no mutations. The immuno-phenotype of the cells by flow cytometry in our case fits with those of HCL-variant as determined by absence of CD25 (1). As was previously shown (2,3), the wild-type BRAF gene that we found in our case gives another molecular support to the diagnosis of HCL-variant. HCL-variant is difficult to differentiate from splenic diffuse red pulp small B-cell lymphoma. However, in our case we have several evidences that are in favor of HCL-variant and against splenic diffuse red pulp small B-cell lymphoma. First, the cells in our case are medium size whereas in splenic diffuse red pulp small B-cell lymphoma cell size should be small monomorphous and with common villous cytology. Second, TRAP staining was determined to be positive in the spleen in our case and according to WHO classification usually not present in splenic diffuse red pulp small B-cell lymphoma. To the best of our knowledge, our case represents the first documentation of HCL-variant with near-tetraploid DNA content in vivo. We found this case important to be reported as this neartetraploid DNA content was associated with atypical morphological appearance of the cells as shown by lack of typical Cytometry Part B (Clinical Cytometry) 94B:169–171 (2018)

Physicians’ lack of knowledge - a possible reason for red blood cell transfusion overuse?

BackgroundA significant percentage of red blood cell transfusions are inappropriately overused. This study investigated physicians from the western Galilee in terms of their knowledge of transfusion medicine as a potential reason for red blood cell overuse, and assessed the influence of personal background characteristics on their knowledge.MethodsData were collected via anonymous questionnaires. The questionnaires included a personal background section and a professional section. Study participants were grouped according to field of specialty, seniority, and location of medical school graduation, in order to correlate participant characteristics with knowledge.ResultsScores were calculated on a 0–100 scale. The overall knowledge of the study population was low (mean score 47.8xa0±xa018.6). Knowledge regarding basic physiology of red blood cell transfusion was also low. Internal medicine physicians and senior physicians had significantly greater overall knowledge scores and were more familiar with a restrictive blood management policy than were surgeons and residents, respectively. Comparing knowledge scores, no difference was found regarding indications for transfusion.ConclusionGeneral and fundamental knowledge in transfusion medicine is lacking among physicians in the non-operating room setting, which may play a role in red blood cell transfusion overuse. Field of specialty and professional status influenced knowledge of transfusion medicine. Educational programs and increased physicians’ awareness might help decrease unnecessary transfusions.Trial registrationNot applicable.

Absolute lymphocyte count as a prognostic marker in newly diagnosed multiple myeloma patients.

Sir, Multiple myeloma (MM), a malignant disorder of plasma cells, is the second most common hematologic malignancy. Different prognostic strategies are used to stratify patients at the time of the diagnosis. The survival of MM patients has improved significantly in the last decade. This improvement can be attributed especially to the use of novel agents in the therapy of MM patients [1]. These include especially two classes of drugs: the immunomodulatory drugs (thalidomide, lenalidomide, and pomalidomide) and proteosome inhibitors (bortezomib, carfilzomib). Several studies suggest a prognostic significance for the absolute lymphocyte count (ALC), as a surrogate marker of the immune status [2], at diagnosis and after autologous stem cell transplantation (ASCT) [3] in patients with myeloma and that the quantitative numbers of CD19 cells at MM diagnosis are associated with superior survival [4]. Myeloma cells survival is dependent on microenvironmental interactions in their niche. Recently, the role of tumor-associated macrophages (TAM) was studied also in the pathogenesis of multiple myeloma. It was shown that macrophages support myeloma cell growth, viability, and drug resistance [5]. Increased peripheral blood absolute monocyte count (AMC) has been reported to be a poor prognostic factor in malignant lymphoproliferative disorders and also in solid tumors [6, 7]. The relationship between the number of circulating monocytes and clinical outcomes was mainly attributed to their role as precursors of TAM. A prognostic significance was also reported for the LMR (lymphocyte/monocyte ratio) in newly diagnosed myeloma patients [8] and also at the start of the conditioning regimen of autologous stem cell transplantation (ASCT) [9]. Until now, to our best knowledge, the statistical value of these measures has not been verified in patients treated with novel agents. We retrospectively evaluated these simple measurable markers, the AMC, the ALC, and the LMR at diagnosis of multiple myeloma patients in our hospital and evaluated their prognostic value in patients treated with novel agents. This study included new multiple myeloma patients who were diagnosed between 2006 and 2014 at Galilee Medical Center, Nahariya, Israel. The diagnosis was made according to the IMWG guidelines for symptomatic MM. Approval for review of the records was obtained from the Institutional Review Board of the Galilee Medical Center. AMC and ALC were obtained at diagnosis from routine complete blood count calculated by Advia 2120 hematology analyzer (Simens). We also collected demographic and clinical characteristics of the patients from their records. Quantity data were described by median and range. Qualitative data were described by frequencies and percentages. Comparisons of quantity data between groups were examined by independent sample t-test or Wilcoxon ranks sum test, as appropriate. Correlation of qualitative variables was examined by chi-squared test or Fisher’s exact test, as appropriate. Overall survival (OS) was measured from the time of diagnosis to the date of death or last follow-up. Univariate and multivariate survival analysis was performed using Cox Regression Model and Kaplan–Meier method with Log Rank (Mantel-Cox) test. All P-values represented were one-sided, and a pvalue<0.05 was considered statistically significant. Sixty-two newly diagnosed MM patients were evaluated. The median age was 69 years (range: 46–88 years); 35 (56.5%) patients were male and 27 (43.5%) female. The paraprotein type was as follows: 33 (55%) IgG, 14 (23.3%) light chain and 13 (21.7%) IgA; 15 (25%) patients were ISS I, 16 (26.7%) were ISS II, 29 (48.3%) were ISS III. Forty (64.5%) patients were treated with chemotherapy, 16 (25.8%) were treated with chemotherapy followed by ASCT, and 6 (9.7%) patients had conservative therapy. Fifty-one patients (82%) were treated with novel agents at diagnosis. The median follow-up for the whole cohort after the diagnosis was 28.2 mo (range 0.5–98.8 months). At the time of writing, 41 (66.1%) of patients were living. The optimal cutoff for the ALC and AMC, and the LMR was set at 1600/lL,

Elevated serum BDNF levels are associated with favorable outcome in CLL patients: Possible link to CXCR4 downregulation

Increased chemokine C-X-C receptor 4 (CXCR4) expression is related to unfavorable outcome in chronic lymphocytic leukemia (CLL). Brain-derived neurotrophic factor (BDNF) is a neuronal growth factor that has been shown previously to interact with CXCR4 in neuronal cells. Here, we studied the in vitro effect of BDNF on CXCR4 expression and chemotaxis toward stromal derived factor-1 (SDF-1) in freshly isolated CLL cells. We also explored the correlations between serum BDNF levels in CLL patients and disease characteristics and clinical course. Incubation of CLL cells with recombinant BDNF (50 ng/mL) resulted in a downregulation of CXCR4 surface expression and atenuated chemotaxis toward SDF-1. Higher serum BDNF levels were associated with a mutated immunoglobulin heavy chain variable (IGHV) gene, an early clinical stage, and a stable clinical course. Our findings suggest that increased circulating blood BDNF may be associated with a favorable effect in CLL. However, the exact mechanism of this favorable effect should be investigated further.

Brain derived neurotropic factor single nucleotide polymorphism Val66Met and serum protein levels are associated with development of vincristine-induced peripheral neuropathy in patients with lymphoma

Vincristine is a chemotherapeutic agent that is associated with chemotherapy-induced peripheral neuropathy (CIPN) (Legha, 1986), although the reason why some patients are more vulnerable to CIPN than others remains unclear. Our preliminary studies, showing a possible link between CIPN and blood levels of brain-derived neurotrophic factor (BDNF) (Azoulay et al, 2014), point to BDNF as a potential biomarker for CIPN. The current study explored the effects of serum BDNF and the BDNF-Val66Met, a single nucleotide polymorphism (SNP) causing deficit in cellular distribution and secretion of BDNF in the neuronal cells (Egan et al, 2003) of patients with nonHodgkin lymphoma (NHL) who develop CIPN. Newly diagnosed NHL patients, treated with a vincristinebased protocol, signed an informed consent and were recruited into the study. Exclusion criteria were: central nervous system involvement, pregnancy and impaired cognitive function. Neurological assessment was performed before treatment initiation (baseline), after three cycles and at the end of therapy. Objective symptoms of polyneuropathy were assessed, using the reduced version of the Total Neuropathy Score (TNSr) (Smith et al, 2008). Additionally, participants completed the Functional Assessment of Cancer Therapy/ Gynaecological Oncology Group-Neurotoxicity (Fact-GogNTx) questionnaire evaluating their subjective polyneuropathy symptoms. Likewise, the Patient Health Questionnaire (PHQ9) was used to assess depression (Gilbody et al, 2007). The BDNF gene DNA region containing the Val66MetSNP was amplified by polymerase chain reaction (PCR) using the primers: P1 (forward) CCTACAGTTCCACCAGGTGAGAAGAGTG and P2 (reverse) TCATGGACATGTTTGCAGCATCTAGGTA. The 401-base pair PCR product was sequenced and the allele-specific G?A substitution was determined. The total level of serum BDNF was quantified using the DuoSet enzyme-linked immunosorbent assay kit (DY278; R&D Systems Inc., Minneapolis, MN, USA). The t-test was performed to compare patients’ baseline clinical score between genotype groups. To avoid interpatient variation in CIPN development and progression, we analysed the maximal clinical score achieved by each patient during treatment. A logistic regression model was used to test the correlation between BDNF levels and clinical scores. All statistical analyses were performed using JMP statistical software (SAS Institute Inc. Cary, NC, USA). The study included 33 patients (Table I). All patients were treated with the R-CHOP protocol (rituximab, cyclophosphamide, doxorubicin, vincristine; prednisolone); 30 patients were treated with 6 courses of treatment, 2 with 4 courses and one received 3 courses. Twenty-two patients had the BDNF Val/Val (i.e., Val-BDNF) genotype, 11 patients harboured Met-BDNF (10 Val/Met and 1 Met/Met). No significant differences were found in demographics and treatment parameters between the two genotype groups. A trend to