Lukáš Predajňa

Characterization of Sour Cherry Isolates of Plum pox virus from the Volga Basin in Russia Reveals a New Cherry Strain of the Virus

Plum pox virus (PPV) is the causal agent of sharka, the most detrimental virus disease of stone fruit trees worldwide. PPV isolates have been assigned into seven distinct strains, of which PPV-C regroups the genetically distinct isolates detected in several European countries on cherry hosts. Here, three complete and several partial genomic sequences of PPV isolates from sour cherry trees in the Volga River basin of Russia have been determined. The comparison of complete genome sequences has shown that the nucleotide identity values with other PPV isolates reached only 77.5 to 83.5%. Phylogenetic analyses clearly assigned the RU-17sc, RU-18sc, and RU-30sc isolates from cherry to a distinct cluster, most closely related to PPV-C and, to a lesser extent, PPV-W. Based on their natural infection of sour cherry trees and genomic characterization, the PPV isolates reported here represent a new strain of PPV, for which the name PPV-CR (Cherry Russia) is proposed. The unique amino acids conserved among PPV-CR and PPV-C cherry-infecting isolates (75 in total) are mostly distributed within the central part of P1, NIa, and the N terminus of the coat protein (CP), making them potential candidates for genetic determinants of the ability to infect cherry species or of adaptation to these hosts. The variability observed within 14 PPV-CR isolates analyzed in this study (0 to 2.6% nucleotide divergence in partial CP sequences) and the identification of these isolates in different localities and cultivation conditions suggest the efficient establishment and competitiveness of the PPV-CR in the environment. A specific primer pair has been developed, allowing the specific reverse-transcription polymerase chain reaction detection of PPV-CR isolates.

Evaluation of the genetic diversity of Plum pox virus in a single plum tree

Genetic diversity of Plum pox virus (PPV) and its distribution within a single perennial woody host (plum, Prunus domestica) has been evaluated. A plum tree was triply infected by chip-budding with PPV-M, PPV-D and PPV-Rec isolates in 2003 and left to develop untreated under open field conditions. In September 2010 leaf and fruit samples were collected from different parts of the tree canopy. A 745-bp NIb-CP fragment of PPV genome, containing the hypervariable region encoding the CP N-terminal end was amplified by RT-PCR from each sample and directly sequenced to determine the dominant sequence. In parallel, the PCR products were cloned and a total of 105 individual clones were sequenced. Sequence analysis revealed that after 7 years of infection, only PPV-M was still detectable in the tree and that the two other isolates (PPV-Rec and PPV-D) had been displaced. Despite the fact that the analysis targeted a relatively short portion of the genome, a substantial amount of intra-isolate variability was observed for PPV-M. A total of 51 different haplotypes could be identified from the 105 individual sequences, two of which were largely dominant. However, no clear-cut structuration of the viral population by the tree architecture could be highlighted although the results obtained suggest the possibility of intra-leaf/fruit differentiation of the viral population. Comparison of the consensus sequence with the original source isolate showed no difference, suggesting within-plant stability of this original isolate under open field conditions.

Molecular characterization of Prune dwarf virus cherry isolates from Slovakia shows their substantial variability and reveals recombination events in PDV RNA3

Although Prune dwarf virus (PDV) is one of the most common viruses infecting stone fruits (Prunus spp.), most of the molecular diversity studies have so far focused on the capsid protein (CP) gene. An alternative diagnostic primer pair targeting the movement protein (MP) gene was used in the present work, increasing then polyvalence of PDV detection in cherry samples from Slovakia as compared to the previously published primers amplifying 5′MP-intergenic region-CP-3′UTR fragment. The nearly complete sequence of the RNA3 from 24 Slovak PDV isolates was determined, together with 19 partial sequences of the MP gene for other isolates. Even though the isolates originated from a geographically limited region, analyses showed a high degree of nucleotide sequence diversity between isolates. No clear-cut phylogenetic grouping based on host or geographical origin could be observed. The topology of the MP and CP trees were incongruent for some isolates. Highly supported recombination signals were detected in five PDV isolates, with breakpoints located at different positions in the central part of RNA3, within or close to the intergenic region. Taken together these results extend our understanding of the variability of PDV and for the first time highlight the contribution of recombination to the evolutionary history of this virus.

FIRST REPORT OF LITTLE CHERRY VIRUS-1 IN SLOVAKIA

Little cherry virus 1 (LChV-1) a member of the newly established genus Velarivirus, family Closteroviridae (Katsiani et al., 2015) is associated with little cherry or shirofugen stunt diseases (Candresse et al., 2013). As LChV-1 was recently detected in Czech Republic and Poland, a survey was undertaken to study its presence in Slovakia by sampling cherries (Prunus avium L.) in various sites (orchards, gardens, old local cherry plantations, botanical collections). Random primer-synthesized cDNA was used for amplification of the putative coat protein (CP) gene (449 bp) using primers 1LC_12776F: 5 TCAAGAAAAGTTCTGGTGTGC3 (sense) and 1LC_ 13223R: 5 CGAGCTAGACGTATCAGTATC3’ (antisense), newly designed based on sequences from databases (www.ncbi.nlm.nih.gov, accessed on April, 2013). Five of ca. 60 cherry samples tested positive for LChV-1 using RT-PCR. LChV-1-infected samples originated from three distinct localities (Bratislava, Ivanka pri Dunaji, Brdarka) and, in all cases, they were recovered from local genotypes older than 20 years. No typical symptoms could be attributed to LChV-1 in cherries identified as infected, which remained in most of cases symptomless. The partial LChV-1 CP sequences obtained in this work and those retrieved from GenBank showed a substantial variability. Five Slovak isolates were genetically homogenous, showing a within group nucleotide divergence of 1.1% (GenBank accession Nos. KP861749, KP861751, KP861755-57). However, these Slovak isolates formed a distinct phylogenetic cluster, divergent from the previously characterised European LChV-1 isolates (nucleotide identity with isolates NC_001836, EU715989 and JX669615 reached 82.3 – 84.2%). The detection of LChV-1 isolates in old local cherry genotypes and the extent of their molecular variability suggests a long-term establishment of this virus in the country. To our knowledge, this is the first report of LChV-1 in Slovakia.

Detection and characterisation of Plum pox virus (PPV) isolates from Eastern Slovakia revealed the presence of three main viral strains.

Plum pox virus (PPV), the agent responsible for Sharka disease, is the most important viral pathogen of stone fruit trees world-wide, having an endemic status in Slovakia. To increase knowledge of PPV diversity in Slovakia, a set of 11 isolates, originated from the eastern part of the country, was characterised. The isolates were chip-budded from their original Prunus hosts to the susceptible GF305 indicators, exhibiting the symptoms of variable severity. A genomic region encompassing the partial NIb and the hypervariable 5´terminal region of the CP gene was amplified from all 11 isolates in RT-PCR and directly sequenced. The phylogenetic analysis revealed the grouping of the 11 Slovak isolates into 3 distinct clusters, representing the PPV-M (2 isolates), D (7 isolates) and Rec strains (2 isolates). The strain affiliation of isolates was further confirmed by strain-specific RT-PCR, using which the presence of additional mixed infection by minor PPV variants was detected in 2 samples. The results further contribute to the understanding of PPV diversity in Slovakia and confirm the specificity and sensitivity of molecular approaches used for the virus strain determination.

Molecular and Biological Characterisation of Turnip mosaic virus Isolates Infecting Poppy (Papaver somniferum and P. rhoeas) in Slovakia

In recent years, the accumulated molecular data of Turnip mosaic virus (TuMV) isolates from various hosts originating from different parts of the world considerably helped to understand the genetic complexity and evolutionary history of the virus. In this work, four complete TuMV genomes (HC9, PK1, MS04, MS15) were characterised from naturally infected cultivated and wild-growing Papaver spp., hosts from which only very scarce data were available previously. Phylogenetic analyses showed the affiliation of Slovak Papaver isolates to the world-B and basal-B groups. The PK1 isolate showed a novel intra-lineage recombination pattern, further confirming the important role of recombination in the shaping of TuMV genetic diversity. Biological assays indicated that the intensity of symptoms in experimentally inoculated oilseed poppy are correlated to TuMV accumulation level in leaves. This is the first report of TuMV in poppy plants in Slovakia.

Grapevine virus T is relatively widespread in Slovakia and Czech Republic and genetically diverse

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

A novel specific duplex real-time RT-PCR method for absolute quantitation of Grapevine Pinot gris virus in plant material and single mites

Grapevine Pinot gris virus (GPGV) is a widely distributed grapevine pathogen that has been associated to the grapevine leaf mottling and deformation disease. With the aim of better understanding the disease epidemiology and providing efficient control strategies a specific and quantitative duplex TaqMan real-time RT-PCR assay has been developed. This method has allowed reliable quantitation of the GPGV titer ranging from 30 up to 3 x 108 transcript copies, with a detection limit of 70 viral copies in plant material. The assay targets a grapevine internal control that reduces the occurrence of false negative results, thus increasing the diagnostic sensitivity of the technique. Viral isolates both associated and non-associated to symptoms from Greece, Slovakia and Spain have been successfully detected. The method has also been applied to the absolute quantitation of GPGV in its putative transmission vector Colomerus vitis. Moreover, the viral titer present in single mites has been determined. In addition, in the current study a new polymorphism in the GPGV genome responsible for a shorter movement protein has been found. A phylogenetic study based on this genomic region has shown a high variability among Spanish isolates and points to a different evolutionary origin of this new polymorphism. The methodology here developed opens new possibilities for basic and epidemiological studies as well as for the establishment of efficient control strategies.