Magdalena Olesiak

Bis(sulfonamide) isosters of mycophenolic adenine dinucleotide analogues : Inhibition of inosine monophosphate dehydrogenase

Synthesis of novel inhibitors of human IMP dehydrogenase is described. These inhibitors are isosteric methylenebis(sulfonamide) analogues 5-8 of earlier reported mycophenolic adenine methylenebis(phosphonate)s 1-3. The parent bis(phosphonate) 1 and its bis(sulfonamide) analogue 5 showed similar sub-micromolar inhibitory activity against IMPDH2 (K(i) approximately 0.2 microM). However, the bis(sulfonamide) analogues 6 and 8 substituted at the position 2 of adenine were approximately 3- to 10-fold less potent inhibitors of IMPDH2 (K(i)=0.3-0.4 microM) than the corresponding parent bis(phosphonate)s 2 and 3 (K(i)=0.04-0.11 microM), respectively.

Improving CRISPR–Cas specificity with chemical modifications in single-guide RNAs

Abstract CRISPR systems have emerged as transformative tools for altering genomes in living cells with unprecedented ease, inspiring keen interest in increasing their specificity for perfectly matched targets. We have developed a novel approach for improving specificity by incorporating chemical modifications in guide RNAs (gRNAs) at specific sites in their DNA recognition sequence (‘guide sequence’) and systematically evaluating their on-target and off-target activities in biochemical DNA cleavage assays and cell-based assays. Our results show that a chemical modification (2′-O-methyl-3′-phosphonoacetate, or ‘MP’) incorporated at select sites in the ribose-phosphate backbone of gRNAs can dramatically reduce off-target cleavage activities while maintaining high on-target performance, as demonstrated in clinically relevant genes. These findings reveal a unique method for enhancing specificity by chemically modifying the guide sequence in gRNAs. Our approach introduces a versatile tool for augmenting the performance of CRISPR systems for research, industrial and therapeutic applications.

Synthesis And Biological Activity of Borane Phosphonate DNA

Abstract Borane phosphonate oligodeoxyribonucleotides are synthesized from 5′-O-[benzhydroxybis(trimethylsilyloxy)silyl]-2′-deoxyribonucleoside-3′-O-methylphosphoramidites. The exocyclic amine functions of adenine, guanine, and cytosine are protected with trimethoxytrityl, and thymine is unprotected. Using these synthons and under standard conditions via activation with S-ethylthiotetrazole, condensations on a highly crosslinked polystyrene support are in excess of 99%. Following the complete synthesis of the oligodeoxyribonucleotide phosphite triester, oxidation with THF·BH3 yields the oligodeoxyribonucleotide borane phosphonate. Further treatment with 80% aqueous acetic acid followed by disodium 2-carbamoyl-2-cyanoethylene-1,1-dithiolate removes trimethoxytrityl from the 2′-deoxyribonucleoside bases and the methyl protecting group from the internucleotide phosphate triester, respectively. Cleavage from the support with ammonium hydroxide and purification by reverse phase HPLC affords the pure oligodeoxyribonucleotide borane phosphonate. These oligomers are taken up by cells in the absence of cationic lipids and transport biologically active interfering RNA into cells.

Synthesis and Biochemical Activity of New Oligonucleotide Analogs

Borane phosphonate deoxyoligonucleotides are synthesized from 5′-O-benzhydroxybis(trimethylsilyloxy)silyl-2′-deoxynucleoside-3′-phosphoramidites. The exocyclic amines of adenine and cytosine are protected with dimethoxytrityl and trimethoxytrityl, respectively, whereas guanine protection is with N2-(9-fluorenylmethoxycarbonyl) or N2-trimethoxytrityl. Thymine is protected with N3-anisoyl. Using these synthons and under standard conditions via activation with tetrazole, condensations in excess of 99% are observed. Oxidation with either THF·BH3 or a peroxyanion solution followed by cleavage of the silyl ether with fluoride completes a cycle. Following synthesis of an appropriate oligomer, protecting groups are removed using sequentially acetic acid, a dithiolate and ammonium hydroxide. Oligodeoxynucleotide 10 mers and 12 mers having any combination of borane phosphonate and phosphate internucleotide linkages as well as all four 2′-deoxynucleotides are synthesized in isolated yields of 70–80% and characterized by phosphorus NMR and mass spectrometry.

Iodine-azide reagent in detection of thiophosphoryl nucleotides in thin-layer chromatography systems

Abstract The TLC detection limits of the phosphorothioate analogs of nucleotides and related compounds by means of UV, iodine, HCl vapours, the iodine–azide reagent and the molybdate reagent have been determined. The iodine–azide reagent has been applied for the selective TLC detection of the phosphorothioate analogs of nucleotides.

Correction to “Silver Nanoassemblies Constructed from Boranephosphonate DNA”

The following correction is required for the DNA sequences used to prepare the A-tile as used in these arrays. On page S22 of the Supporting Information, a typographical error within the sequences of DNA oligomers A4 and A5 used for the construction of the DNA arrays led to an insertion of an extra base pair in the A-tile. These were typographical errors and were not present in the DNAs used to construct the arrays. The correct sequences are given here and in the corrected Supporting Information: A1: GATGGCGACATCCTGCCGCTATGATTACACAGCCTGAGCATTGACAC A2: GTAGCGCCGTTAGTGGATGTC A3: TGTAGTATCGTGGCTGTGTAATCATAGCGGCACCAACTGGCA A4: GACTGCGTGTCAATGCTCACCGATCAACCAG A5: CTGACGCTGGTTGATCGGACGATACTACATGCCAGTTGGACTAACGG B1a: CAGTGACCGCATCGGACAGCAGC‐T B1b: CGCTACCGTGCATCATGGACTAAC B2: CGTCAGGCTGCTGTGGTCGTGC B3: AGTACAACGCCACCGATGCGGTCACTGGTTAGTGGATTGCGT B4: GCCATCCGTCGATACGGCACCATGATGCACG B5: GCAGTCGCACGACCTGGCGTCTGTTGGCTTTTGCCAACAGTTTGTACTACGCAATCCTGCCGTATCGACG The sequences reported by Winfree et al. were used. In B1a, an extra thymidine residue at the 3′ end was added as a convenience for synthesis of boranephosphonate DNA. It allowed the use of commercially available solid support linked 2′-deoxythymidine. The quality of the arrays was not altered by the addition of this terminal nucleotide. We note in the Winfree et al. manuscript as referenced here that hairpin looped structures extending above/below the arrays were added without affecting the tiles. The following comments are added in order to clarify various questions regarding the original publication:

Studies of Asymmetric Induction in the Synthesis of Dinucleoside Phosphorothioates from 2-Oxo-1,3,2-dithiaphospholane Nucleoside Derivatives

The nucleoside derivatives, containing at 3′-O or 5′-O-position 2-oxo-1,3,2-dithiaphospholane function were found to react in the presence of DBU with a hydroxyl group of appropriately protected nucleosides to yield, after deprotection, dinucleoside phosphorothioates in moderate yields. An asymmetric induction connected with the formation of new chiral phosphorothioate center has been examined.