María Luisa Guevara-Fujita

The canine copper toxicosis locus is not syntenic with ATP7B or ATX1 and maps to a region showing homology to human 2p21.

Canine copper toxicosis (CT) is an autosomal recessive disorder resulting in accumulation of copper at toxic levels in the liver owing to deficient excretion via the bile (Hardy et al. 1975). This disorder is prevalent in certain breeds, most notably the American and British Bedlington Terrier, where disease allele frequencies as high as 0.5 are present, resulting in phenotype frequencies of 25% affected and 50% carriers (Herrtage et al. 1987). Affected dogs develop excessive amounts of copper in their liver and, if untreated, will die of liver disease between 3 and 7 years of age. The gene responsible for canine CT is unknown, but candidates include ATP7B, the gene responsible for Wilson disease in humans (Bull et al. 1993; Tanzi et al. 1993), and the ATX1 (ATOX1 or HAH1) gene, which codes for a copper chaperone that delivers copper to ATP7B within liver cells (Klomp et al. 1997; Hung et al. 1998). Wilson disease in humans is similar to canine CT in that it is also an autosomal recessive disorder where copper accumulates in the liver owing to deficient copper excretion in the biliary system (Brewer and Yuzbasiyan-Gurkan 1992; Bull and Cox 1994). The protein product of ATP7B is a P-type ATPase which is expressed in the liver, kidney, and brain and functions to transport copper in the secretory pathway. Patients with Wilson disease accumulate excess copper primarily in their liver, and over time copper levels in the brain also increase, leading to a movement-type neurological disorder. Thus, the clinical phenotype is similar to canine CT, but differences exist. Neurological manifestations are not seen in canine CT, and affected Wilson disease patients have low levels of ceruloplasmin in their serum, while affected Bedlington terriers have normal levels of serum ceruloplasmin. In addition, the subcellular localization of copper accumulation in the liver differs between affected Wilson disease patients and affected Bedlington terriers. Wilson disease patients accumulate copper in their periportal hepatocytes, while affected Bedlington terriers accumulate copper in the center of the lobules (Owen and Ludwig 1982). HAH1 (ATOX1) (Klomp et al. 1997), the human ortholog of yeast Atx1p, is a cytoplasmic protein that functions as a copper chaperone and is thought to shuttle copper from the cell membrane to both ATP7B and ATP7A (Pufahl et al. 1997) localized in the trans Golgi complex (Dierick et al. 1997; Payne et al. 1998). While not as strong a candidate as the ATP7B gene, it is possible that a mutation in ATX1 could result in liver cirrhosis via interfering with the normal function of ATP7B without affecting the activity of ATP7A. No mammalian disorders have yet been attributed to a mutation in the ATX1 gene. Yuzbasiyan-Gurkan et al. (1997) performed linkage analysis with several Bedlington terrier pedigrees of the American Kennel Club to identify DNA microsatellite marker C04107 as being tightly linked to the CT locus with a LOD score of 5.96 at recombination fraction of zero. This polymorphic marker has been successfully applied in molecular diagnostic tests for CT in Bedlington terriers (Holmes et al. 1998; Ubbink et al. 1998). In an earlier study (Yuzbasiyan-Gurkan et al. 1993), the CT locus was found to be unlinked to the esterase D (ESD) and retinoblastoma (Rb1) loci, both of which show strong linkage to Wilson disease in humans. This suggested that the CT and ATP7B loci were different and unlinked in the dog, but data on linkage of the canine ATP7B, Rb1, and ESD loci is lacking and could differ from that seen in the human genome. In the present study, fluorescent in situ hybridization (FISH) was performed to determine whether candidate genes ATP7B or ATX1 mapped to the same or to different chromosomal locations from C04107. If either ATP7B or ATX1 mapped to the same chromosomal locus as C04107, it would suggest that CT may be a result of a mutation in that gene. If they mapped to different chromosomes, this would strongly support the hypothesis that another gene involved in mammalian copper transport or homeostasis is responsible for canine CT. A canine BAC library constructed from Doberman Pinscher DNA (Roswell Park Cancer Institute, RPCI, Buffalo, N.Y.) was screened with random primed (RediprimeTM II DNA Labeling System, Amersham Life Sciences, Arlington Heights, Ill.) P-labeled probes prepared from PCR products specific for the C04107, ATP7B, and ATX1 loci. PCR primers (forward-58 CCGGATCCTTTAGATGGGAC 38; reverse-58 CAGGTACCCAAGTCATTTGTCTATC 38) designed from sequence upstream of the cytosine-adenine (CA) repeat of microsatellite marker C04107 were used with dog spleen total genomic DNA as template in PCR reactions to generate the CT-specific probe. An ATP7B-specific probe was generated from a PCR reaction using primers (forward58 GACAAAACTGGCACCATACGCACG 38; reverse-58 GTTCTGGAGCTCCTGGACCTTGGCCAG 38) designed from canine exons 14 and 18 and a canine cDNA subclone, which contains ATP7B transmembrane domains 6–8, as template. HAH1 (ATX1) specific primers (forward-58 CAGTCATGCCGAAGCACGAG 38; reverse-58 CTGAGGGTCTCCGCAGGAAC 38) were used with human cDNA as template in a PCR reaction to generate a probe which was used in cross-species hybridization of the canine BAC filters. All PCR products used as probes were checked by sequencing with an Applied Biosystems model 373A automated sequencer. Positive BAC clones were purchased from RPCI and verified as having the correct loci by PCR and Southern blot analysis as well as sequencing. Canine BAC clones 27N21 and 225B1 contain the CA microsatellite C04107 as well as the upstream sequence used to generate the CT-specific probe. Minimally, exons 17 and 18 of the ATP7B gene are contained within BAC clone 243F13, while BAC clone 84B18 contains the ATX1 gene. To map the chromosomal location of these loci, BAC clones Correspondence to: S.L. Dagenais Mammalian Genome 10, 753–756 (1999).

Chromosomal assignment of seven genes on canine chromosomes by fluorescence in situ hybridization

Our group has developed more than 600 DNA markers to build a map of the canine genome. Of these markers, 125 correspond to genes (anchor loci). Here we report the first six autosomal genes assigned to canine chromosomes by fluorescence in situ hybridization (FISH), using cosmid DNA: adenine phosphoribosyl transferase on Chromosome (Chr) 3; creatine kinase muscle type on Chr 4; pyruvate kinase liver and red blood cell type on Chr 2; and colony-stimulating factor-1 receptor, glucose transporter protein-2, and tumor protein p53 on Chr 5. These assignments are based on the karytotype proposed by Stone and associates (Genome 34, 407, 1991) using high-resolution techniques. In addition, we have assigned the Menkes gene to the X Chr of the dog.

Five Novel RPGR Mutations in Families with X- Linked Retinitis Pigmentosa

X‐linked forms of retinitis pigmentosa (XLRP) are among the most severe because of their early onset, often leading to significant visual impairment before the fourth decade. RP3, genetically localized at Xp21.1, accounts for 70% of XLRP in different populations. The RPGR (Retinitis Pigmentosa GTPase Regulator) gene that was isolated from the RP3 region is mutated in 20% of North American families with XLRP. From mutation analysis of 27 independent XLRP families, we have identified five novel RPGR mutations in 5 of the families (160delA, 789 A>T, IVS8+1 G>C, 1147insT and 1366 G>A). One of these mutations was detected in a family from Chile. Hum Mutat 17:151, 2001.

Recurrent Myocilin Asn480lys Glaucoma Causative Mutation Arises De Novo in a Family of Andean Descent

PurposeTo search for MYOC mutations in Peruvian primary open angle glaucoma (POAG) families. Patients and MethodsTwo patients from each of the 11 POAG Peruvian families were screened for sequence variants in MYOC coding exons by conformational sensitive gel electrophoresis and sequencing was performed on the samples indicating probable sequence changes. ResultsWe detected 2 families bearing distortions of conformational sensitive gel electrophoresis indicating mutations. Sequencing of these samples revealed coding sequence changes. A native Andean descent family presented with a MYOC mutation, Asn480Lys (C→G at nucleotide 1440). This is different from the previously reported C→A change at nucleotide 1440 that causes Asn480Lys in 2 unrelated French and Dutch families with glaucoma of variable expressivity, and indicates a third independent event. A second family of admixed origin showed the presence of the known Arg76Lys polymorphism. ConclusionsIn the study of MYOC variants in 11 POAG Peruvian families, we have found a family of ethnically admixed origin with polymorphism Arg76Lys and a family of Andean descent bearing a third event of the Asn480Lys, the MYOC mutation that has been reported in the highest number of POAG patients (>80 cases). Analysis of this family could contribute with information about disease manifestation, progression, and treatment response in the context of a distinct genetic background and also climatic, altitude, and socioeconomical conditions.

Mutational analysis of BRCA1 and BRCA2 genes in Peruvian families with hereditary breast and ovarian cancer

Breast cancer is one of the most prevalent malignancies in the world. In Peru, breast cancer is the second cause of death among women. Five to ten percent of patients present a high genetic predisposition due to BRCA1 and BRCA2 germline mutations.

Three novel polymorphic microsatellite markers for the glaucoma locus GLC1B by datamining tetranucleotide repeats on chromosome 2p12-q12

In order to identify new markers around the glaucoma locus GLC1B as a tool to refine its critical region at 2p11.2-2q11.2, we searched the critical region sequence obtained from the UCSC database for tetranucleotide (GATA)n and (GTCT)n repeats of at least 10 units in length. Three out of four potential microsatellite loci were found to be polymorphic, heterozygosity ranging from 64.56% to 79.59%. The identified markers are useful not only for GLC1B locus but also for the study of other disease loci at 2p11.2-2q11.2, a region with scarcity of microsatellite markers.