Maria Rosaria Cardillo

Human herpesvirus 6 infection in neoplastic and normal brain tissue

The presence and variant distribution of human herpesvirus 6 (HHV‐6) was investigated by a nested polymerase chain reaction (PCR) in 118 biopsies from patients affected by nervous tissue tumor (115 primary tumors and 3 metastasis) and in 31 autopsy samples from the brain of healthy individuals. HHV‐6 DNA sequences were detected in normal and neoplastic nervous tissue at a frequency of 32% and 37%, respectively. In both tissues, variant A was three times more frequent than the variant B. Peripheral blood lymphocytes (PBLs) derived from seven tumor affected patients contained the same variant as their respective brain sample, as judged by PCR. The expression of HHV‐6 encoded immediate early protein p41 was detected by immunohistochemistry in neoplastic but not in normal brain. This may reflect viral reactivation from latency in immunocompromised patients. The seroepidemiological data indicated a frequency distribution of anti‐HHV‐6 antibodies in patients with brain tumors similar to that found in healthy donors. J. Med. Virol. 63:45–51, 2001.

Effects of the lipidosterolic extract of Serenoa repens (Permixon®) on human prostatic cell lines

Permixon® is a drug used in the treatment of benign prostatic hyperplasia. We studied its androgenic and antiandrogenic effects in the prostatic cell lines LNCaP and PC3, respectively responsive and unresponsive to androgen stimulation.

Detection of human papillomavirus DNA, P53 and KI67 expression in penile carcinomas

Our study is aimed at evaluating the presence of p53 and Ki67 expression by immunohistochemistry in a series of 11 paraffin-embedded penile carcinomas. We also investigated the presence of Human Papillomavirus (HPV) DNA in these tumours and performed an accurate typing by DNA sequencing on positive samples. Immunohistochemistry (IHC) was performed with the anti-p53 and Ki67 mouse monoclonal antibodies. DNA extracted from small sections of each specimen was submitted to amplification with HPV specific general primers; PCR products of the proper length were purified and sequenced. IHC demonstrated nuclear accumulation of mutated p53 and Ki 67 expression in 10/11 tumour samples (90.9%). The prevalence of HPV DNA was 72.7%; the most prevalent type was HPV16. Sequencing analysis revealed the presence of HPV53 (12.5%), HPV18 (25%) and HPV16 (62.5%). Out of the p53 or Ki67 positive carcinomas the percentage of HPV positives was 80% and 70% respectively. Our results indicate that penile carcinoma is frequently associated to high risk HPV and with diffuse p53 and Ki67 expression.

Fine-needle aspiration cytology of superficial lymph nodes

A series of 244 enlarged superficial lymph nodes was examined by fine‐needle aspiration cytology. Twenty‐nine smears (11.9%) were inadequate for study. Of the remaining 215, 108 were negative, 13 suspicious for malignancy, and 94 positive. Forty‐five excisional biopsies were performed correlating the cytologic and histologic findings. There were two cytologic false‐negative results; both were patients who had been treated for carcinoma and whose aspirates were cytologically negative. Of the 13 samples reported as suspicious for malignancy, there were three epidermoid carcinomas, nine reactive hyperplasias, and one non‐Hodgkins lymphocytic lymphoma. Of the positive cases, 83 were metastatic tumors, and 11 were malignant lymphomas (two non‐Hodgkins lymphomas and nine Hodgkins lymphomas). The criteria used in the interpetration of these aspirates and the problems of differential cytological diagnosis are discussed. In spite of the drawbacks of inadequate and false‐negative smears, fine‐needle aspiration cytology is valuable in preliminary diagnosis of diseased lymph nodes and subsequent management.

AgNOR counts are useful in cervical smears

Because they present marked cellular changes, the cytological appearances of epithelial repair may be confused with those of cancer. To see whether the Ag‐NOR staining technique for nucleolar organizer regions would be useful to distinguish benign proliferative reactions (squamous metaplasia and repair) from cervical intra‐epithelial neoplasia (CIN I, CIN II, and CIN III), we studied a series of cervical smears. The smears, previously stained with the Papanicolaou technique, were destained and restained with Ag‐NOR silver. Significantly different (P < 0.05) Ag‐NOR counts were found in squamous metaplasia, epithelial repair, and various degrees of CIN. The Ag‐NOR technique appears useful in the diagnosis of cervical cytology and particularly in cases with marked cellular change, which could be confused with neoplasia.

Reliability of PSA circulating cells as markers of metastatic prostate cancer

We read with great interest the article published in the SJCLI by Lintula et al. [1]. To investigate the influence of prostatic surgery and endocrine treatment on prostatic cells in the circulation of 56 patients undergoing biopsy, radical prostatectomy, transurethral resection of the prostate (TURP), orchiectomy, or androgen blockade they developed a quantitative reverse transcription-polymerase chain reaction (RT-PCR) method for detecting prostate specific antigen (PSA) mRNA in peripheral blood (PB) samples before, during, and up to 26 weeks after these procedures. PSA mRNA levels increased after RP, TURP, or orchiectomy and became undetectable within 1 – 3 days. No significant correlation was found between PCR positivity and the clinical characteristics of the patients, serum PSA, stage, or grade. The investigators conclude that the increased levels of PSA mRNA in PB after prostatic surgery indicate temporary dissemination of prostatic cells. Published data nevertheless suggest that increasing levels of PSA mRNA in PB after prostatic surgery do not necessarily indicate temporary dissemination of prostatic cells; nor can RT-PCR PSA-positive cells help in gauging the extent of disease progression after radical prostatectomy for prostate cancer [2]. Our study reporting PSA circulating cells in PB from 1 of 11 untreated patients with apparently localized cancers, without recurrent disease developed within 24 months after RP, support these proposals. In a preliminary study, designed to investigate these matters, we amplified cDNA (250 ng) in PB from 42 patients with treated or untreated prostate carcinoma (CaP) and with benign prostatic hyperplasia (BPH) (controls) by RT-PCR, using the following primers: sense, located in exon 2: 5’TGTCCGTGACGTGGATTGGTG3’; antisense, located in exon 4: 5’CATGGAGGTCCACACACTGAA3’ using 40 cycles 40 (94‡C for 30@, 65‡C for 30 min and 72‡C for 60 s) of PSA [3] and as control sense, located in exon 1: 5’AGCACAGAGCCTCGCCTTTG3’; antisense located in exon 4: 5’TGGCCATCTCTTGCTCGAAG3’ using 30 cycles (94‡C for 30 min, 56‡C for 30 min and 72‡C for 60 s) for human b-actin [4]. We studied three clinical groups: 11 patients with CaP who underwent androgen ablation (AA) followed by retropubic radical prostatectomy (RP) (2 tumors were Gleason score sum 4, 7 Gleason sum 7, and 2 Gleason sum 8; 7 tumors were organ-confined diseases (T2N0) and 4 were extra-prostatic diseases (T3b). Follow-up after treatment ranged from 3 to 84 months (mean 27 months). At the time of venipuncture for PB, we distinguished two subgroups: patients who responded to the first 24 months of treatment without clinical progression; and patients who received neoadjuvant androgen deprivation therapy because recurrent disease developed within 24 months after RP. The second subgroup comprised 11 patients with elevated serum PSA levels (more than 4.0 ng/mL), who had been given a diagnosis of CaP based on TRUS-guided prostate biopsy (1 tumor was Gleason sum 6 and 10 were Gleason sum 7). All 11 patients had organ-confined disease. In patients treated for CaP, PB samples were obtained 27 to 84 months (mean 55 months) after treatment ended; in patients who had received a diagnosis of CaP based on clinical and biochemical evidence of malignancy, PB samples were obtained before biopsy and before treatment began. The control group comprised 20 men aged 50 years or older with no known malignancy, with a histologic Scand J Clin Lab Invest 2004; 64: 687–690

Can p503s, p504s and p510s gene expression in peripheral-blood be useful as a marker of prostatic cancer?

BackgroundThe aim of the study was to investigate whether p503S, p504S and p510S gene expression in peripheral-blood be useful as a diagnostic or prognostic marker of prostatic cancer.MethodsCirculating cells were identified by reverse transcription-polymerase chain reaction (RT-PCR) to detect p503S, p504S and p510S mRNA in peripheral blood (PB) from 11 patients with treated prostatic carcinoma (CaP), 11 with newly-diagnosed untreated CaP and 20 with benign prostatic hyperplasia (BPH) (controls).ResultsRT-PCR amplified P503S in 7 of 11 untreated and 2 of 11 treated patients with CaP and 5 of 20 with BPH; p504S in 7 of 11 untreated and in 9 of 11 treated patients with CaP and 11 of 20 with BPH; whereas it amplified p510S in all subjects with CaP and in 15 of 20 with BPH.ConclusionThese findings suggest that the investigated genes are poorly specific and probably of little use as diagnostic or prognostic prostatic markers in peripheral blood for monitoring disease progression and recurrence.

Correspondence re: Ghosh A and Heston WDW. Tumor target prostate specific membrane antigen (PSMA) and its regulation in prostate cancer. J Cell Biochem 91:528-539, 2004.

We read with great interest the article published in the Journal of Cellular Biochemistry by Ghosh and Heston [2004], reporting prostate specific membrane antigen (PSMA) as a unique membrane bound protein, which is overexpressed manifold in prostate cancer (CaP) as well as in the neovasculature of most solid tumors but not in the vasculature of normal tissues. PSMA is up-regulated in CaP, metastatic disease and hormone refractory CaPs, and its expression ismodulated inversely by androgen levels. Owing to its intriguing though unexplained distribution, PSMA can serve as a detecting agent for metastatic foci of primary cancer. PSMA can also be used as a target of imaging agents to detect metastatic tumor sites, and also to detect prostate cells in circulation or lymphatics. In contrast toGhosh andHeston [2004] and in agreement with others [Grasso et al., 1998; Hara et al., 2002], we doubt the real usefulness of PSMA in detecting prostatic cells in peripheral blood (PB), in identifying patients at an increased risk of disseminated cancer and in defining the prognosis of disease. In a preliminary study, we amplified cDNA (250 ng) in PB from 42 patients with treated or untreated CaP and with benign prostatic hyperplasia (BPH) (controls) by PCR using the following primers: sense, located in exon 14: 50AAAGTCCTTCCCCAGAGTTCA30; antisense located in exon 17: 50GAGTCTCTCACTGAACTTGGA30 of PSMA [Israeli et al., 1993] using 30 cycles (948C for 30min, 578Cfor30min, and728Cfor60 s) andas control sense, located in exon 1: 50AGCACAGAGCCTCGCCTTTG30; antisense located in exon 4: 50TGGCCATCTCTTGCTCGAAG30 using 30 cycles (948C for 30 min, 568C for 30 min, and 728C for 60 s) for human b-actin [NakajimaJijima et al., 1985]. We studied three clinical groups, 11 patients with CaP who underwent androgen ablation (AA) followed by retropubic radical prostatectomy (RP) (2 tumors were Gleason score sum 4, 7 Gleason sum 7, and 2 Gleason sum 8; 7 tumors were organ-confined diseases (T2 N0); and 4 were extra-prostatic diseases (T3b N0, N,1 and N2), follow-up after treatment ranged from 3 to 84 months (mean 27 months). At the time of venipuncture for PB, we distinguished two subgroups: patients who responded to the first 24 months of treatment without clinical progression; and AA resistant patients who received neoadjuvant androgen deprivation therapy because recurrent disease developed within 24 months after RP. The second subgroup comprised 11 patients with elevated serum PSA levels (more than 4.0 ng/ml), who had received a diagnosis of CaP

Human papillomavirus DNA in cervical intraepithelial neoplasia detected by in situ hybridisation

Human papillomavirus (HPV) infection was investigated by in situ hybridisation in histological sections from 38 women with abnormal Papanicolaou smears. 13 patients had condylomatous lesions without atypia, 15 cervical intraepithelial neoplasia (CIN) I, 4 CIN II, 3 CIN III and 2 carcinoma in situ (CIS). HPV DNA was detected in 29 cases (78%) (1 specimen was technically inadequate). HPV 16 and 18, and 31, 33 and 35 were both present (67%) in CIN III. HPV 6 and 11 were more frequent in CIN I (56%) and in condylomatous lesions (38%). 31% of the condylomatous lesions without atypia contained HPV 31, 33, and 35 and 31% of those with CIN I were infected with HPV 16 and 18. These data confirm the frequent association of HPV infection with cervical cancer and CIN, and indicate that in situ hybridisation can identify patients with specific types of HPV infection at risk for cervical cancer.

Human papilloma virus DNA detection, p53 and Ki67 expression in penile verrucous and squamous cell carcinomas in the same patient.

I October 1998, a 44-year-old, heterosexual, married, Italian man, white race, referred to the Urology Clinic, “Sapienza” University of Rome, presented with a verrucous– surfaced nodule on the penis. He reported having noted the lesion for the first time 3 months before; the patient was not affected by other significant diseases. Physical examination showed a 2 cm, fungating, cauliflowerlike tumor with a large base located on the prepuce and coronal sulcus on the ventral side of the penis, without provoking pain. A local excision of the tumor was performed. The surgical specimen grossly measured 3.2 cm and appeared as an exophytic grey-white mass that involved the glans. Microscopically, it appeared as a differentiated papillary neoplasm with acanthosis and hypercheratosis, with variable length papillations and inconspicuous fibrovascular cores. The nuclei were round bland with slight atypias in the basal layer. Koilocytic changes were not evident. The tumor extended into the underlying stroma. The histologic diagnosis was verrucous carcinoma (Fig. 1A), stage I (pT1, N0, M0) according to TNM classification.1 We also established the proliferation index, as evaluated by Ki67 immunohistochemistry positivity, and the level of p53 reactivity.2 Immunohistochemical analysis of p53 and Ki67 demonstrated a low nuclear accumulation of mutated p53 and Ki67 proteins (20%). Physical examination and computed tomography were performed in each following year: no obvious masses were found in the inguinal or paraortic areas or in distant visceral organs, and no evidence of local recurrence was found. In October 2003, 5 years after the primary surgical treatment, the patient showed a 2 cm white ulcerated nodule within the scar of the primary operation. A second excision was performed and the specimens were taken for histologic and virological analysis. Grossly the nodule showed a 3 cm size superficially spreading with horizontal growth and superficial invasion. Microscopically the tumor presented moderate grade of differentiation, with predominant well differentiated keratinizing areas and some solid nonkeratinizing poorly differentiated areas. Small irregular nests or cords of atypical cells were present in lamina propria. The tumor was histologically diagnosed as squamous cell carcinoma (SCC) (Fig. 1B), stage II (pT2, NO, M0). Physical examination and computed tomography scan analysis were performed in the each following years, and no obvious masses were found in the inguinal or paraortic areas or in distant visceral organs. The p53 and Ki67 immunoreactivity showed high levels, 95% and 90%, respectively. A sample from the surgical specimens was taken for Human Papillomavirus (HPV) investigation. Total cellular DNA was purified from the sample and analysed for the presence of genomic DNA of any HPV type. Aliquots of the purified DNA were employed in PCR assays for checking the suitability of the sample (HLA gene) and amplifying a portion (450 bp) of HPV L1 gene with MY09-MY11 degenerated consensus primers3 (Fig. 1C). At the same time, samples were collected from the paraffin embedded block of the first tumor. DNA was extracted from small sections, using NucleoSpin Tissue kit (Machery Nagel), according to the manufacturer’s recommendations for paraffin-embedded tissue. Reduced DNA yield and fragmentation in fixed compared to fresh tissue were expected; MY09-MY11 primers did not allow detection of any HPV PCR products, so sample DNA was tested with the widely used general primers elongated at their 3 ends (GP5 /GP6 ).4 The shortness of the amplicon (150-bp fragment in L1) renders the amplification appropriate in DNA extracted from paraffin-embedded tissue, allowing the detection of a broad spectrum of mucosotropic HPV. Each PCR reaction was electrophoresed on agarose gel in parallel with positive (2 ng of plasmid containing the entire genome of different HPV genotypes) and negative (the complete reaction mix without DNA) controls (Fig. 1D), and PCR products of the proper length were purified and sequenced by automatic DNA sequencer (Applied Biosystem, mod.370A), according to Manufacturer’s specifications (Amplicycle Kit, Applied Biosystem). Sequence homology was determined by BLAST and Clustal W programs. In paraffin embedded sample of the first tumor, GP5 /GP6 primers amplified a fragment showing 99% identity to HPV18; whereas in the fresh biopsy from the second tumor, DNA of the probably high-risk (HR) HPV53 was found with MY09-MY11 primers. Moreover, in order to exclude the concomitant presence of other HPV, another PCR, amplifying E6/7 genes was performed on the HPV53 positive sample. In this PCR,5 a mixture of 4 couples of degenerated primers was employed to detect 36 different HPV genotypes amplifying fragments of various length (600–750 bp). The sequence analysis of the obtained amplicon confirmed the presence of HPV53 DNA (98% identity). From the *Departments of Urology, †Experimental Medicine, Section of Virology, “Sapienza” University of Rome, Rome, Italy; and ‡Section of Histopathology, “Sapienza” University of Rome, Rome, Italy. Supported by grant from Ministero dell’Università, Istruzione, Ricerca scientifica, MIUR-Italia. Correspondence: Anna Marta Degener, PhD, Department of Experimental Medicine, Section of Virology, “Sapienza” University, Viale di Porta Tiburtina, 28, 00185 Rome–ITALY. E-mail address: annamarta.degener@uniroma1.it. Received for publication August 12, 2008, and accepted February 4, 2009. DOI: 10.1097/OLQ.0b013e31819f6c2f Copyright