Martha Sedegah
Naval Medical Research Center
                                 Network
                            
                            Latest external collaboration on country level. Dive into details by clicking on the dots.
                                 Publication
                            
                            Featured researches published by Martha Sedegah.
Science | 2013
Robert A. Seder; Lee Jah Chang; Mary E. Enama; Kathryn L. Zephir; Uzma N. Sarwar; Ingelise J. Gordon; LaSonji A. Holman; Eric R. James; Peter F. Billingsley; Anusha Gunasekera; Adam Richman; Sumana Chakravarty; Anita Manoj; Soundarapandian Velmurugan; Minglin Li; Adam Ruben; Tao Li; Abraham G. Eappen; Richard E. Stafford; Sarah Plummer; Cynthia S. Hendel; Laura Novik; Pamela Costner; Floreliz Mendoza; Jamie G. Saunders; Martha Nason; Jason H. Richardson; Jittawadee Murphy; Silas A. Davidson; Thomas L. Richie
Malaria Sporozoite Vaccine Each year, hundreds of millions of people are infected with Plasmodium falciparum, the mosquito-borne parasite that causes malaria. A preventative vaccine is greatly needed. Seder et al. (p. 1359, published online 8 August; see the Perspective by Good) now report the results from a phase I clinical trial where subjects were immunized intravenously with a whole, attenuated sporozoite vaccine. Three of 9 subjects who received four doses and zero of 6 subjects who received five doses of the vaccine went on to develop malaria after controlled malaria infection. Both antibody titers and cellular immune responses correlated positively with the dose of vaccine received, suggesting that both arms of the adaptive immune response may have participated in the observed protection. Intravenous immunization with an attenuated whole malaria sporozoite vaccine protected volunteers in a phase I clinical trial. [Also see Perspective by Good] Consistent, high-level, vaccine-induced protection against human malaria has only been achieved by inoculation of Plasmodium falciparum (Pf) sporozoites (SPZ) by mosquito bites. We report that the PfSPZ Vaccine—composed of attenuated, aseptic, purified, cryopreserved PfSPZ—was safe and wel-tolerated when administered four to six times intravenously (IV) to 40 adults. Zero of six subjects receiving five doses and three of nine subjects receiving four doses of 1.35 × 105 PfSPZ Vaccine and five of six nonvaccinated controls developed malaria after controlled human malaria infection (P = 0.015 in the five-dose group and P = 0.028 for overall, both versus controls). PfSPZ-specific antibody and T cell responses were dose-dependent. These data indicate that there is a dose-dependent immunological threshold for establishing high-level protection against malaria that can be achieved with IV administration of a vaccine that is safe and meets regulatory standards.
Science | 2011
Judith E. Epstein; K. Tewari; Kirsten E. Lyke; B. K. L. Sim; Peter F. Billingsley; Matthew B. Laurens; Anusha Gunasekera; Sumana Chakravarty; Eric R. James; Martha Sedegah; Adam Richman; Soundarapandian Velmurugan; Sharina Reyes; Ming Lin Li; Kathryn Tucker; Adriana Ahumada; Adam Ruben; Tao Li; Richard E. Stafford; Abraham G. Eappen; C. Tamminga; Jason W. Bennett; Christian F. Ockenhouse; Jittawadee Murphy; J. Komisar; N. Thomas; Mark Loyevsky; Ashley Birkett; Christopher V. Plowe; C. Loucq
The efficacy of a sporozoite-based malaria vaccine is tested in humans, nonhuman primates, and mice. Our goal is to develop a vaccine that sustainably prevents Plasmodium falciparum (Pf) malaria in ≥80% of recipients. Pf sporozoites (PfSPZ) administered by mosquito bites are the only immunogens shown to induce such protection in humans. Such protection is thought to be mediated by CD8+ T cells in the liver that secrete interferon-γ (IFN-γ). We report that purified irradiated PfSPZ administered to 80 volunteers by needle inoculation in the skin was safe, but suboptimally immunogenic and protective. Animal studies demonstrated that intravenous immunization was critical for inducing a high frequency of PfSPZ-specific CD8+, IFN-γ–producing T cells in the liver (nonhuman primates, mice) and conferring protection (mice). Our results suggest that intravenous administration of this vaccine will lead to the prevention of infection with Pf malaria.
Vaccine | 2000
Thong P. Le; Kevin M. Coonan; Richard C. Hedstrom; Yupin Charoenvit; Martha Sedegah; Judith E. Epstein; Sanjai Kumar; Ruobing Wang; Denise L. Doolan; Jason Maguire; Suezanne E. Parker; Peter Hobart; Jon Norman; Stephen L. Hoffman
DNA-based vaccines are considered to be potentially revolutionary due to their ease of production, low cost, long shelf life, lack of requirement for a cold chain and ability to induce good T-cell responses. Twenty healthy adult volunteers were enrolled in a Phase I safety and tolerability clinical study of a DNA vaccine encoding a malaria antigen. Volunteers received 3 intramuscular injections of one of four different dosages (20, 100, 500 and 2500 microg) of the Plasmodium falciparum circumsporozoite protein (PfCSP) plasmid DNA at monthly intervals and were followed for up to twelve months. Local reactogenicity and systemic symptoms were few and mild. There were no severe or serious adverse events, clinically significant biochemical or hematologic changes, or detectable anti-dsDNA antibodies. Despite induction of excellent CTL responses, intramuscular DNA vaccination via needle injection failed to induce detectable antigen-specific antibodies in any of the volunteers.
Human Vaccines | 2010
Stephen L. Hoffman; Peter F. Billingsley; Eric R. James; Adam Richman; Mark Loyevsky; Tao Li; Sumana Chakravarty; Anusha Gunasekera; Rana Chattopadhyay; Minglin Li; Richard E. Stafford; Adriana Ahumada; Judith E. Epstein; Martha Sedegah; Sharina Reyes; Thomas L. Richie; Kirsten E. Lyke; Robert Edelman; Matthew B. Laurens; Christopher V. Plowe; B. Kim Lee Sim
Immunization of volunteers by the bite of mosquitoes carrying radiation-attenuated Plasmodium falciparum sporozoites protects greater than 90% of such volunteers against malaria, if adequate numbers of immunizing biting sessions and sporozoite-infected mosquitoes are used. Nonetheless, until recently it was considered impossible to develop, license and commercialize a live, whole parasite P. falciparum sporozoite (PfSPZ) vaccine. In 2003 Sanaria scientists reappraised the potential impact of a metabolically active, non-replicating PfSPZ vaccine, and outlined the challenges to producing such a vaccine. Six years later, significant progress has been made in overcoming these challenges. This progress has enabled the manufacture and release of multiple clinical lots of a 1(st) generation metabolically active, non-replicating PfSPZ vaccine, the Sanaria PfSPZ Vaccine, submission of a successful Investigational New Drug application to the US Food and Drug Administration, and initiation of safety, immunogenicity and protective efficacy studies in volunteers in MD, US. Efforts are now focused on how best to achieve submission of a successful Biologics License Application and introduce the vaccine to the primary target population of African children in the shortest possible period of time. This will require implementation of a systematic, efficient clinical development plan. Short term challenges include optimizing the (1) efficiency and scale up of the manufacturing process and quality control assays, (2) dosage regimen and method of administration, (3) potency of the vaccine, and (4) logistics of delivering the vaccine to those who need it most, and finalizing the methods for vaccine stabilization and attenuation. A medium term goal is to design and build a facility for manufacturing highly potent and stable vaccine for pivotal Phase 3 studies and commercial launch.
Infection and Immunity | 2001
Robert A. Gramzinski; Denise L. Doolan; Martha Sedegah; Heather L. Davis; Arthur M. Krieg; Stephen L. Hoffman
ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.
Journal of Clinical Investigation | 1996
Gil Mor; Galina Yamshchikov; Martha Sedegah; Mitsuhiro Takeno; Ruobing Wang; Richard A. Houghten; Stephen L. Hoffman; Dennis M. Klinman
Plasmid DNA vaccines capable of preventing viral, bacterial, and parasitic infections are currently under development. Our labs have shown that a plasmid DNA vaccine encoding the circumsporozoite protein of the malaria parasite elicits protective immunity against live sporozoite challenge in adult BALB/c mice. We now find that the same DNA vaccine induces tolerance rather than immunity when administered to 2-5 d-old mice. Neonatally tolerized animals were unable to mount antibody, cytokine or cytotoxic responses when rechallenged with DNA vaccine in vitro or in vivo. Tolerance was specific for immunogenic epitopes expressed by the vaccine-encoded, endogenously produced antigen. Mice challenged with exogenous circumsporozoite protein produced antibodies against a different set of epitopes, and were not tolerized. These findings demonstrate important differences in the nature and specificity of the immune response elicited by DNA vaccines versus conventional protein immunogens.
Journal of Immunology | 2000
Diana Haddad; Jayanthi Ramprakash; Martha Sedegah; Yupin Charoenvit; Roxanne E. Baumgartner; Sanjai Kumar; Stephen L. Hoffman; Walter R. Weiss
Plasmid-encoded GM-CSF (pGM-CSF) is an adjuvant for genetic vaccines; however, little is known about how pGM-CSF enhances immunogenicity. We now report that pGM-CSF injected into mouse muscle leads to a local infiltration of potential APCs. Infiltrates reached maximal size on days 3 to 5 after injection and appeared in several large discrete clusters within the muscle. Immunohistological studies in muscle sections from mice injected with pGM-CSF showed staining of cells with the macrophage markers CD11b, Mac-3, IAd/Ed and to the granulocyte marker GR-1 from day 1 through day 14. Cells staining with the dendritic cell marker CD11c were detected only on days 3 to 5. Muscles injected with control plasmids did not stain for CD11c but did stain for CD11b, Mac-3, IAd/Ed, and GR-1. No staining was observed with the APC activation markers, B7.1 or CD40, or with markers for T or B cells. These findings are consistent with the infiltrating cells in the pGM-CSF-injected muscles being a mixture of neutrophils, macrophages, and immature dendritic cells and suggest that the i.m. APCs may be enhancing immune responses to coinjected plasmid Ags. This hypothesis is supported by data showing that 1) separation of injections with pGM-CSF and Ag-expressing plasmid into different sites did not enhance immune responses and 2) immune enhancement was associated with the presence of CD11c+ cells in the infiltrates. Thus, pGM-CSF enhancement may depend on APC recruitment to the i.m. site of injection.
The Journal of Infectious Diseases | 2007
Judith E. Epstein; Suchitra Rao; Frank Williams; Daniel Freilich; Thomas C. Luke; Martha Sedegah; Patricia de la Vega; John B. Sacci; Thomas L. Richie; Stephen L. Hoffman
BACKGROUND Challenge of volunteers by the bites of membrane-fed anopheline mosquitoes infected with Plasmodium falciparum was reported in 1986. In 1997, an analysis of experience with 118 volunteers indicated that mosquito inoculation of P. falciparum could be a safe, well-tolerated, reproducible, and efficient method of challenge. METHODS We reviewed the records of 47 volunteers challenged at our institution with the NF54 isolate of P. falciparum between 1998 and 2002. We also reviewed data from 17 published studies of experimental challenge conducted since 1996. RESULTS At our institution, the time to onset of first symptoms (incubation period) was 8.9 days, and the time to first detectable parasitemia on blood smear (prepatent period) was 10.5 days. All volunteers became symptomatic. Most symptoms were mild to moderate, although 21% of volunteers had at least 1 severe symptom. None developed complicated or severe malaria, and all were cured. Laboratory assessments demonstrated modest, short-term abnormalities typical of malaria. Review of 17 published studies demonstrated that an additional 367 volunteers received experimental challenge safely with similar outcomes. CONCLUSIONS In total, data from 532 volunteers demonstrate that experimental challenge is safe and results in predictable incubation and prepatent periods. Our findings support the continued use of this method for testing efficacy of vaccines and drugs against P. falciparum.
PLOS ONE | 2013
Ilin Chuang; Martha Sedegah; Susan Cicatelli; Michele Spring; Mark E. Polhemus; Cindy Tamminga; Noelle B. Patterson; Melanie L. Guerrero; Jason W. Bennett; Shannon McGrath; Harini Ganeshan; Maria Belmonte; Fouzia Farooq; Esteban Abot; Jo Glenna Banania; Jun Huang; Rhonda Newcomer; Lisa Rein; Dianne Litilit; Nancy O. Richie; Chloe Wood; Jittawadee Murphy; Robert W. Sauerwein; Cornelus C. Hermsen; Andrea McCoy; Edwin Kamau; James F. Cummings; Jack Komisar; Awalludin Sutamihardja; Meng Shi
Background Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. Methodology/Principal Findings The vaccine regimen was three monthly doses of two DNA plasmids (DNA) followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad). The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1). The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea), possibly related to immunization, was severe (Grade 3), preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27%) were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44–817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5–102) and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13–408; AMA1 348, range 88–1270) and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019). Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. Significance The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%). Protection was associated with cell-mediated immunity to AMA1, with CSP probably contributing. Substituting a low seroprevalence vector for Ad5 and supplementing CSP/AMA1 with additional antigens may improve protection. Trial Registration ClinicalTrials.govNCT00870987.
PLOS ONE | 2011
Cindy Tamminga; Martha Sedegah; David P. Regis; Ilin Chuang; Judith E. Epstein; Michele Spring; Jose Mendoza-Silveiras; Shannon McGrath; Santina Maiolatesi; Sharina Reyes; Victoria Steinbeiss; Charlotte Fedders; Kathryn Smith; Brent House; Harini Ganeshan; Jennylynn Lejano; Esteban Abot; Glenna Banania; Renato Sayo; Fouzia Farooq; Maria Belmonte; Jittawadee Murphy; Jack Komisar; Jackie Williams; Meng Shi; Donald Brambilla; Nalini Manohar; Nancy O. Richie; Chloe Wood; Keith Limbach
Background A protective malaria vaccine will likely need to elicit both cell-mediated and antibody responses. As adenovirus vaccine vectors induce both these responses in humans, a Phase 1/2a clinical trial was conducted to evaluate the efficacy of an adenovirus serotype 5-vectored malaria vaccine against sporozoite challenge. Methodology/Principal Findings NMRC-MV-Ad-PfC is an adenovirus vector encoding the Plasmodium falciparum 3D7 circumsporozoite protein (CSP). It is one component of a two-component vaccine NMRC-M3V-Ad-PfCA consisting of one adenovector encoding CSP and one encoding apical membrane antigen-1 (AMA1) that was evaluated for safety and immunogenicity in an earlier study (see companion paper, Sedegah et al). Fourteen Ad5 seropositive or negative adults received two doses of NMRC-MV-Ad-PfC sixteen weeks apart, at particle units per dose. The vaccine was safe and well tolerated. All volunteers developed positive ELISpot responses by 28 days after the first immunization (geometric mean 272 spot forming cells/million[sfc/m]) that declined during the following 16 weeks and increased after the second dose to levels that in most cases were less than the initial peak (geometric mean 119 sfc/m). CD8+ predominated over CD4+ responses, as in the first clinical trial. Antibody responses were poor and like ELISpot responses increased after the second immunization but did not exceed the initial peak. Pre-existing neutralizing antibodies (NAb) to Ad5 did not affect the immunogenicity of the first dose, but the fold increase in NAb induced by the first dose was significantly associated with poorer antibody responses after the second dose, while ELISpot responses remained unaffected. When challenged by the bite of P. falciparum-infected mosquitoes, two of 11 volunteers showed a delay in the time to patency compared to infectivity controls, but no volunteers were sterilely protected. Significance The NMRC-MV-Ad-PfC vaccine expressing CSP was safe and well tolerated given as two doses, but did not provide sterile protection. Trial Registration ClinicalTrials.gov NCT00392015
