Martina Böhm

The course of ADAMTS‐13 activity and inhibitor titre in the treatment of thrombotic thrombocytopenic purpura with plasma exchange and vincristine

The therapeutic efficacy of plasma exchange (PE) in thrombotic thrombocytopenic purpura (TTP) is attributed to the restoration in ADAMTS‐13 (a disintegrin and metalloproteinase with thrombospondin motif‐13) activity by substitution of the enzyme and removal of ADAMTS‐13‐neutralizing autoantibodies. We explored this rationale by analysing ADAMTS‐13 activity and corresponding inhibitor levels during PE‐treatment in 27 episodes from 23 adults with TTP. All patients with an initial episode of TTP (n = 14) and nine of 11 patients with a relapse showed severe ADAMTS‐13 deficiency. ADAMTS‐13 inhibitors were detected in 81% of these patients. Twenty‐one patients responded to PE‐therapy and two patients died. For patients with severe ADAMTS‐13 deficiency, 15 patients (71%) showed a PE‐induced recovery in ADAMTS‐13 activity and six patients (29%) had persistent severe ADAMTS‐13 deficiency despite clinical response. Three patients with recurrent TTP demonstrated a permanent increase in inhibitor titre during therapy. Six patients (43%) with an initial episode of TTP displayed a transient increase in inhibitor titre during PE‐therapy, which was associated with deterioration in clinical and haematological symptoms of TTP. Treatment with vincristine induced an immediate increase in platelet count and ADAMTS‐13 activity in seven of eight patients. We conclude that ADAMTS‐13 activity and inhibitor levels, as measured using current methodology, do not solely determine the clinical course of TTP.

Cold storage of citrated whole blood induces drastic time- dependent losses in factor VIII and von willebrand factor : potential for misdiagnosis of haemophilia and von willebrand disease

This study investigates the effect of pre-analytic storage conditions on the laboratory evaluation of von Willebrand disease (VWD) and haemophilia. Samples from healthy controls and patients with VWD were stored as whole blood and as separated plasma, both at room temperature and on crushed ice, for two different time periods (3 or 6 h). In samples from healthy individuals (n = 10) and in patients with suspected type 1 VWD (n = 10), storage of whole blood on ice caused a drastic time-dependent decrease in von Willebrand factor (VWF):ristocetin cofactor activity, in VWF:antigen activity and factor VIII activity (mean ± SD) to 35 ± 18, 55 ± 23 and 53 ± 15% of baseline levels after 6 h storage, respectively. Patients with type 2 VWD and non-detectable VWF:ristocetin cofactor activity did not demonstrate such drastic cold-induced losses in VWF and factor VIII levels. Storage of plasma caused only minor changes in VWF levels. The cold-induced loss in VWF might thus depend on the presence of platelets and of high molecular weight VWF. Chilling of platelets induces a clustering of the glycoprotein Ib subunit. We therefore hypothesize that cold-induced loss in VWF might be due to a cold-promoted binding of VWF to glycoprotein VWF receptor Ib alpha. These results suggest a serious potential for misdiagnosis of haemophilia or VWD due to inappropriate pre-analytical handling of blood.

Increased incidence of thrombophilic abnormalities in patients with cranial dural arteriovenous fistulae.

Abstract Cranial dural arteriovenous fistulae (DAVF) may occur post-traumatic or sporadic. The physiopathologic mechanisms of sporadic DAVF are still unclear. A dural sinus thrombosis followed by an increase in venous pressure and/or an increased procoagulatory activity of the coagulation system are associated at least with some DAVF. The objective of this study was to investigate the coagulation profile in patients with DAVF. Thus the association of thrombophilic abnormalities, sinus thrombosis and DAVF should be analyzed. A total of 15 patients with cranial DAVF were included in this study. Blood samples were analyzed for 20210A mutation of the prothrombin gene, resistance to activated protein C and factor V Leiden mutation. Fibrinogen (Fib), Textarin time (TT), antithrombin (AT), protein C and protein S activity, von Willebrand factor antigen (vWF:Ag), Ristocetin cofactor activity (vWF:RCo), D-Dimer (DD) and coagulation factor VIII-activity (F VIII) were determined in all patients. Blood was screened for the occurrence of lupus antiphospholipid antibodies and cardiolipin antibodies. Thrombophilic risk factors were found in 5 (33%) of the 15 patients with cranial DAVF. Four patients had a heterozygote 20210A mutation of the prothrombin gene and one patient had a heterozygote FV Leiden mutation. Sinus thrombosis was detected in two patients with grade 2b DAVF and was associated with a 20210A mutation of the prothrombin gene in both patients. Additionally, one patient had deficient protein C activity and screening for cardiolipin antibodies was positive in three patients. In the current series the frequency of prothrombin Gene 20210A mutation was higher in patients with DAVF compared to the general population, whereas the incidence of Factor V Leiden mutation was not. Therefore in patients with cranial DAVF thrombophilic abnormalities should be considered in the post-operative/post-interventional management.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

This study demonstrates that two cases of severe ADAMTS13 deficiency are mechanistically caused by the association of two different gene defects acting at two different levels. Background In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. Design and Methods In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. Results In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. Conclusions In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Patterns of changes of anti-ADAMTS13 after plasma exchange

An enzyme-linked immunosorbent assay (ELISA) has recently been developed to detect antibodies against the von Willebrand factor-cleaving protease ADAMTS13 in patients with thrombotic thrombocytopenic purpura (TTP). The ELISA is based on incubation of plasma with immobilized recombinant ADAMTS13 followed by visualization of IgG and IgM antibodies by means of secondary enzyme-labeled antibodies [1]. In a recent study, anti-ADAMTS13 IgG antibodies were detected in most patients with TTP (97%) characterized by severe ADAMTS13 deficiency (< 10% of normal) [1]. The ELISA was more sensitive than the standard inhibitor assay based upon ADAMTS13 neutralizing activity, which gave positive results in 80% of patients [1]. The study, carried out in patients with acute untreated TTP, gave no information on the value of the ELISA in monitoring patients with immunomediated TTP during treatment with plasma exchange. We subsequently investigated three patients (two with chronic recurrent TTP and one with a first acute episode that recurred) before, during and after plasma exchange. These clinical cases illustrate examples of the parallel changes of platelet count, ADAMTS13 activity, anti-ADAMTS13 inhibitory activity and IgG antibody titers. A 53-year-old male with chronic recurrent TTP (Fig. 1) was first investigated during clinical remission (platelet count 92 · 10 9 L )1 ), when his ADAMTS13 activity was below 6%, and anti-ADAMTS13 antibodies undetectable by inhibitor assay and ELISA (panel A, time I). Six days later he had a clinical relapse and his platelets spontaneously decreased to 42 · 10 9 L )1 , with inhibitory activity 0.5 BU mL )1 and the ELISA detected a weak anti-ADAMTS13 IgG titer (1:20) (panel A, time II). The patient was then treated with two sessions of plasma exchange, which rapidly normalized his platelet count. Twelve days later, when the patient was off therapy, his platelet count decreased again to 10 · 10 9 L )1 , with an increase in inhibitory activity to 16 BU mL )1 (data not shown). He was treated again with nine sessions of plasma exchange within 28 days (five plasma exchange sessions daily and subsequently with four additional sessions within the next 23 days). After the last exchange session he had a stable platelet count (148 · 10 9 L )1 ), but persistently severe ADAMTS13 deficiency (< 6%), and his inhibitory activity rose to 5B U mL )1 and IgG antibody titer was markedly increased