Maxime Gualtieri

Identification of a new antimicrobial lysine-rich cyclolipopeptide family from Xenorhabdus nematophila

Entomopathogenic bacteria of the genus Xenorhabdus are known to be symbiotically associated with soil dwelling nematodes of the Steinernematidae family. These bacteria are transported by their nematode hosts into the hemocoel of the insect larvae, where they proliferate and produce insecticidal proteins, inhibitors of the insect immune system and antimicrobial molecules. In this study, we describe the discovery of a new family (PAX) of five antimicrobial compounds produced by fermentation of the Xenorhabdus nematophila F1 strain and purified by cation exchange chromatography and reversed phase chromatography. The chemical structure of PAX 3, a lysine-rich cyclolipopetide, was obtained from the analysis of homo and heteronuclear 2D NMR and confirmed by MS-MS experiments. The five members of the PAX family showed significant activity against plants and human fungal pathogens and moderate activity against few bacteria and yeast. No cytotoxicity was observed on CHO or insect cells.

In Vitro Activities of Different Inhibitors of Bacterial Transcription against Staphylococcus epidermidis Biofilm

ABSTRACT Staphylococcus epidermidis is a major cause of nosocomial infections because of its ability to form biofilms on the surface of medical devices. Only a few antibacterial agents are relatively active against biofilms, and rifampin, a transcription inhibitor, ranks among the most effective molecules against biofilm-related infections. Whether this efficacy is due to advantageous structural properties of rifampin or to the fact that the RNA polymerase is a favorable target remains unclear. In an attempt to answer this question, we investigated the action of different transcription inhibitors against S. epidermidis biofilm, including the newest synthetic transcription inhibitors. This comparison suggests that most of the antibiotics that target the RNA polymerase are active on S. epidermidis biofilms at concentrations close to their MICs. One of these compounds, CBR703, despite its high MIC ranks among the best antibiotics to eradicate biofilm-embedded bacteria.

Mutation in the Bacillus subtilis RNA Polymerase β′ Subunit Confers Resistance to Lipiarmycin

Lipiarmycin (Lprm) (8), a macrocyclic antibiotic also known as tiacumicin (2), is currently under development under the name of OPT-80 (Optimer Pharmaceuticals, Inc., San Diego, Calif.) as a narrow-spectrum antibacterial agent to treat Clostridium difficile-associated diarrhea (1, 7). Lprm is a transcription inhibitor, but unlike rifampin and streptolydigin, it preferentially inhibits holoenzyme transcription at a much greater rate than it inhibits transcription of the core enzyme (5, 6). Genetic mapping experiments in Bacillus subtilis indicate that mutants are located between loci determining rifampin resistance and streptolydigin resistance (6). To precisely identify the positions of the mutations, we selected lipiarmycin-resistant colonies and sequenced the domains of the RNA polymerase located between these two loci. Lprm was produced and purified by fermentation of Actinoplanes deccanensis (DSMZ 43806) by the method of Talpaert et al. (8). Mutant strains were isolated as spontaneous variants of Bacillus subtilis CIP 52.62 that were able to form colonies on nutrient agar plates containing Lprm (40 μg/liter). At this concentration the frequency of resistant colonies was less than 10−7. Among the 10 resistant colonies selected, 8 exhibited an increased MIC for several classes of antibiotics and were likely to be permeability mutants (Table ​(Table1).1). Two mutants (mut1 and mut2) were highly resistant to Lprm. TABLE 1. Antibiotic resistance and transcription activity of Lprm-resistant Bacillus subtilis To correlate the resistance phenotypes with the activity of Lprm on the RNA polymerase, we tested enzymes from the wild-type and mutant colonies in an in vitro transcription assay by the method of Sonenshein et al. (6). The parent cells (CIP 52.62) and mutant cells specifically resistant to Lprm (mut1 and mut2) showed the same pattern of sensitivity to rifampin. In contrast, the transcription activity of the wild-type cells was more strongly affected by the addition of Lprm than was the activity of either mut1 or mut2. This confirmed the link between resistance to Lprm resistance and transcription. mut3 to mut10 strains were equally sensitive to rifampin and Lprm, suggesting that the resistance was not due to a mutation in the polymerase. After purification of the genomic DNA, we PCR amplified and sequenced the regions located between the loci determining rifampin and streptolydigin resistance. The following primers were used: 5′-1285CGTGTGGTTCGTGAGAGAATGT1306-3′, 5′-3257TAAGCTTCAAGTGCCCAAACCT3236-3′, and 5′-2524CTTGTTGGTAAAGTAACGCCTA2545-3′ for rpoB and 5′-1163CGTTTCGCACTCTTAATGTTGTG1141-3′, 5′-593CACAAGGACAACGCCGTAC611-3′, and 5′-2804GTTAACTGTGTACCAGGCTCACC2782-3′ for rpoC. A point mutation resulting in the substitution of the R326 of rpoC by L (CG[T/C]TT) was found in mut1 and mut2 in a highly conserved region; no mutation was detected in mut3 to mut10. When the PCR product harboring the R326L mutation was transfected into B. subtilis CIP 52.62, the frequency of lipiarmycin-resistant bacteria was 100-fold higher than the frequency observed for bacteria with the wild-type fragment. By analogy with the three-dimensional structure of the Thermus aquaticus enzyme (3), R326 is located in proximity to region 3.2 of σ, which in turn occupies the same space as the exiting RNA transcript (3). This could delineate a new binding site for transcription inhibitors.

The Antibiotics in the Chemical Space

Ensuring the availability of new antibiotics to eradicate resistant pathogens is a critical issue, but very few new antibacterials have been recently commercialized. In an effort to rationalize their discovery process, the industry has utilized chemical library and high-throughput approaches already applied in other therapeutical areas to generate new antibiotics. This strategy has turned out to be poorly adapted to the reality of antibacterial discovery. Commercial chemical libraries contain molecules with specific molecular properties, and unfortunately systemic antibacterials are more hydrophilic and have more complex structures. These factors are critical, since hydrophobic antibiotics are generally inactive in the presence of serum. Here, we review how the skewed distribution of systemic antibiotics in chemical space influences the discovery process.

Cabanillasin, a new antifungal metabolite, produced by entomopathogenic Xenorhabdus cabanillasii JM26

Since the early 1980s, fungi have emerged as a major cause of human disease. Fungal infections are associated with high levels of morbidity and mortality, and are now recognized as an important public health problem. Gram-negative bacterial strains of genus Xenorhabdus are known to form symbiotic associations with soil-dwelling nematodes of the Steinernematidae family. We describe here the discovery of a new antifungal metabolite, cabanillasin, produced by Xenorhabdus cabanillasii. We purified this molecule by cation-exchange chromatography and reverse-phase chromatography. We then determined the chemical structure of cabanillasin by homo- and heteronuclear NMR and MS-MS. Cabanillasin was found to be active against yeasts and filamentous fungi involved in opportunistic infections.

Use of a Surface Plasmon Resonance Method To Investigate Antibiotic and Plasma Protein Interactions

ABSTRACT The pharmacologic effect of an antibiotic is directly related to its unbound concentration at the site of infection. Most commercial antibiotics have been selected in part for their low propensity to interact with serum proteins. These nonspecific interactions are classically evaluated by measuring the MIC in the presence of serum. As higher-throughput technologies tend to lose information, surface plasmon resonance (SPR) is emerging as an informative medium-throughput technology for hit validation. Here we show that SPR is a useful automatic tool for quantification of the interaction of model antibiotics with serum proteins and that it delivers precise real-time kinetic data on this critical parameter.

Draft Genome Sequence and Annotation of the Entomopathogenic Bacterium Xenorhabdus szentirmaii Strain DSM16338.

ABSTRACT We report the genome sequence of Xenorhabdus szentirmaii DSM16338 (4.84 Mb), a symbiont of the entomopathogenic nematode Steinernema rarum. This strain produces antimicrobial activity.

Total Synthesis and Structure-Activity Relationships Study of Odilorhabdins, a New Class of Peptides Showing Potent Antibacterial Activity.

The spread of antibiotic-resistant pathogens is a growing concern, and new families of antibacterials are desperately needed. Odilorhabdins are a new class of antibacterial compounds that bind to the bacterial ribosome and kill bacteria through inhibition of the translation. NOSO-95C, one of the first member of this family, was synthesized for the first time, and then a structure-activity relationships study was performed to understand which groups are important for antibacterial activity and for inhibition of the bacterial translation. Based on this study an analogue showing improved properties compared to the parent compound was identified and showed promising in vitro and in vivo efficacy against Enterobacteriaceae.