Michael Haryadi Wibowo

Frequency and risk-factors analysis of Escherichia coli O157:H7 in Bali-cattle

Cattle are known as the main reservoir of zoonotic agents verocytotoxin-producing Escherichia coli. These bacteria are usually isolated from calves with diarrhea and/or mucus and blood. Tolerance of these agents to the environmental conditions will strengthen of their transmission among livestock. A total of 238 cattle fecal samples from four sub-districts in Badung, Bali were used in this study. Epidemiological data observed include cattle age, sex, cattle rearing system, the source of drinking water, weather, altitude, and type of cage floor, the cleanliness of cage floor, the slope of cage floor, and the level of cattle cleanliness. The study was initiated by culturing of samples onto eosin methylene blue agar, then Gram stained, and tested for indole, methyl-red, voges proskauer, and citrate, Potential E.coli isolates were then cultured onto sorbitol MacConkey agar, and further tested using O157 latex agglutination test and H7 antisera. Molecular identification was performed by analysis of the 16S rRNA gene, and epidemiological data was analyzed using STATA 12.0 software. The results showed, the prevalence of E. coli O157:H7 in cattle at Badung regency was 6.30% (15/238) covering four sub districts i.e. Petang, Abiansemal, Mengwi, and Kuta which their prevalence was 8.62%(5/58), 10%(6/60), 3.33%(2/60), and 3.33(2/60)%, respectively. The analysis of 16S rRNA gene confirmed of isolates as an E. coli O157:H7 strain with 99% similarities. Furthermore, the risk factors analysis showed that the slope of the cage floor has a highly significant effect (P<0.05) to the distribution of infection. Consequently, implementing this factor must be concerned in order to decrease of infection.

Defining “Sector 3” Poultry Layer Farms in Relation to H5N1-HPAI—An Example from Java, Indonesia

SUMMARY. To help guide surveillance and control of highly pathogenic avian influenza subtype H5N1 (H5N1-HPAI), the Food and Agriculture Organization of the United Nations in 2004 devised a poultry farm classification system based on a combination of production and biosecurity practices. Four “Sectors” were defined, and this scheme has been widely adopted within Indonesia to guide national surveillance and control strategies. Nevertheless, little detailed research into the robustness of this classification system has been conducted, particularly as it relates to independent, small to medium-sized commercial poultry farms (Sector 3). Through an analysis of questionnaire data collected as part of a survey of layer farms in western and central Java, all of which were classified as Sector 3 by local veterinarians, we provide benchmark data on what defines this sector. A multivariate analysis of the dataset, using hierarchical cluster analysis, identified three groupings of the farms, which were defined by a combination of production-and biosecurity-related variables, particularly those related to farm size and (the lack of) washing and disinfection practices. Nevertheless, the relationship between production-related variables and positive biosecurity practices was poor, and larger farms did not have an overall higher total biosecurity score than small or medium-sized ones. Further research is required to define the properties of poultry farms in Indonesia that are most closely related to effective biosecurity and the prevention of H5N1-HPAI.

Field effectiveness of highly pathogenic avian influenza H5N1 vaccination in commercial layers in Indonesia

Although vaccination of poultry for control of highly pathogenic avian influenza virus (HPAIV) H5N1 has been practiced during the last decade in several countries, its effectiveness under field conditions remains largely unquantified. Effective HPAI vaccination is however essential in preventing incursions, silent infections and generation of new H5N1 antigenic variants. The objective of this study was to asses the level and duration of vaccine induced immunity in commercial layers in Indonesia. Titres of H5N1 haemagglutination inhibition (HI) antibodies were followed in individual birds from sixteen flocks, age 18–68 week old (wo). The study revealed that H5N1 vaccination had highly variable outcome, including vaccination failures, and was largely ineffective in providing long lasting protective immunity. Flocks were vaccinated with seven different vaccines, administer at various times that could be grouped into three regimes: In regime A, flocks (n = 8) were vaccinated two or three times before 19 wo; in regime B (n = 2), two times before and once after 19 wo; and in regime C (n = 6) three to four times before and two to three times after 19 wo. HI titres in regime C birds were significantly higher during the entire observation period in comparison to titres of regime A or B birds, which also differed significantly from each other. The HI titres of individual birds in each flock differed significantly from birds in other flocks, indicating that the effectiveness of field vaccination was highly variable and farm related. Protective HI titres of >4log2, were present in the majority of flocks at 18 wo, declined thereafter at variable rate and only two regime C flocks had protective HI titres at 68 wo. Laboratory challenge with HPAIV H5N1 of birds from regime A and C flocks confirmed that protective immunity differed significantly between flocks vaccinated by these two regimes. The study revealed that effectiveness of the currently applied H5N1 vaccination could be improved and measures to achieve this are discussed.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Result: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Cloning and sequencing gB, gD, and gM genes to perform the genetic variability of bovine herpesvirus-1 from Indonesia

Aim: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely related to subtype-1 based on glycoprotein D genes. This study aimed to analyze the genetic variability of the BHV-1 isolated from the recent case in Indonesia not only based on gD but also other genes such as gB and gM and to study the homology and similarity of the sample to other BHV-1 isolated in other countries or regions. Materials and Methods: Samples were drawn from the tracheal organ in recent field case and prepared for DNA extraction. The gB, gD, and gM were amplified using nested polymerase chain reaction (nPCR) with our specifically designed primer pair and based on the specified bands of 350 bp gB, 325 bp gD, and 734 bp gM confirmed as BHV-1. The PCR product was ligated into pGEM-T and transformed into competent Escherichia coli. The purified plasmid was subsequently sequenced. Results: The virus sample isolated from the recent field case of infectious bovine rhinotracheitis (IBR) from Indonesia showed variability based on the gB, gD, and gM sequences. However, all of the genes had high similarity (98-100%) to BHV-1.2. Conclusion: The recent field case of IBR in Indonesia was similar to BHV-1.2.

Use of M2e ELISAs for longitudinal surveillance of commercial poultry in Indonesia vaccinated against highly pathogenic avian influenza

In countries where highly pathogenic avian influenza virus (HPAIV) H5N1 is endemic and controlled by vaccination, post-vaccination serological monitoring is essential to differentiate vaccinated poultry from those that are infected. The objectives of this study were to validate two experimental ELISAs that detect antibodies raised against the M2e protein of avian influenza virus that can be used for DIVA purposes. Results from the sM2e and tM2e ELISAs were compared with other conventional tests for the detection of H5N1influenza virus (virus isolation and RT-PCR) using samples collected from 16 commercial flocks in Indonesia. These comprised vaccinated layers aged between 18 and 68 weeks old that were sampled at ten-weekly intervals. A small number of sera were positive in sM2e and tM2e ELISA, 14 (0.6%) and 17 (0.7%) respectively, with low OD420 (0.1-0.3), but only 4 sera were positive in both tests. At the flock level, the incidence of M2e positive sera was low (4%), well below previously established minimum of 40% for an HPAIV H5N1-infected flock. Conventional M and H5 gene RT-PCRs indicated that none of 16 flocks were infected at any time during the study. No virus was isolated from any of the 480 pooled swab samples, except from one, for which the combined data analysis suggest to be the result of a laboratory cross-contamination. Clinical disease, mortalities or reduction in production performance, indicative of field H5N1 challenge, were not observed either in any of the flocks. Birds from two surveyed flocks, challenged in the laboratory with an Indonesian HPAIV H5N1 developed M2e antibodies in 50% and 55% of surviving birds with OD420 in the range of 0.35-1.47 in tM2e ELISA, confirming the validity of the criteria established for use of M2e ELISA for DIVA purposes. Overall these results showed that the tM2e ELISA could be a useful monitoring tool to ascertain freedom from H5N1 infections in vaccinated commercial poultry.

Isolasi dan Identifikasi Bakteri dari Tinja Orangutan Penderita Gangguan Gastrointestinal (BACTERIAL ISOLATION AND IDENTIFICATION IN FAECES OF ORANGUTAN WITH GASTROINTESTINAL DISTURBANCE)

Orangutans are among protected animals by the law. One of orangutans’ main health problems isgastrointestinal disease due to bacterial infection. Microbiological data of causative agent of illness inorangutan still not much reported scientifically. This research aim was to identify causative agent ofbacterial infection on gastrointestinal disorder in orangutan isolated from stool samples. The sampleswere collected from Yayasan Konservasi Alam Yogyakarta and Borneo Orangutan Survival, Semboja,Kalimantan Timur. Fresh fecal samples were collected using sterile swab and put them into a steriletransport media. To achieve pure cultures, bacterial isolation was performed by using plate streaking onselective media. Gram stain was done to confirm the cell uniformity and morphology. Bacterialidentification was performed according to Bergey’s Manual Determinative Bacteriology on some biochemicalcharacters to determine the isolated bacteria. The result showed that three bacteria were identified fromstool samples orangutan from Yayasan Konservasi Alam Yogyakarta, i.e.: Citrobacter amalonaticus,Providensia rustigianii, and Proteus mirabilis. Meanwhile, three bacteria, which were Klebsiella planticola,Enterobanter agglomerans and Escherichia coli, were also identified in samples taken from Borneo orangutan.

ANALISIS MOLEKULER FILOGENETIK DAN STRUKTUR ANTIGENIC VIRUS AVIAN INFLUENZA SUBTIPE H5N1 ISOLAT LAMPUNG TAHUN 2008-2013

Penelitian ini bertujuan melakukan karakterisasi molekuler antigenic site terhadap isolat virus avian influenza (AI) Balai Penyidikan dan Pengujian Veteriner (BPPV) Regional III Lampung dari tahun 2008-2013. Amplifikasi RNA dilakukan dengan teknik reverse transcription polymerase chain reaction (RT-PCR) menggunakan 4 pasang primer referens dari Australian Animal Health Laboratory (AAHL) Geelong Australia (HA10, HA20, dan HA30) dan dilanjutkan dengan proses pengurutan. Analisis hasil pengurutan dengan menggunakan perangkat lunak MEGA versi 5.05 yang meliputi multiple alignment, deductive amino acids prediction, dan phylogenic tree analysis diperoleh hasil perbedaan genetik antar isolat Lampung dari tahun 2003-2013 ditemukan berkisar 1,1-9,1% dengan tingkat homologi mencapai 90,9-98,9%. Variasi genetik ditemukan adanya substitusi pada posisi 53 (R53K), 126 (D126E), 136 (P136), 138 (H138Q, dan H138L), 140 (R140K, R140S, dan R140N), 141 (S141P), dan 189 (K189R). Berdasarkan analisis filogenic tree isolat Lampung tahun 2008-2011 termasuk ke dalam clade 2.1.3. Analisis filogenik isolat AI tahun 2012-2013 yang menginfeksi unggas air mempunyai homologi sekitar 98,5-99,1% dibandingkan dengan isolat AI yang menginfeksi unggas air asal Jawa dan termasuk ke dalam clade 2.3.2.1.

EFEKTIVITAS PENGOBATAN PREPARAT KOMBINASI AMOKSISILIN DAN KOLISTIN SULFAT PADAKASUS INFEKSI BUATAN Escherichia coli PATOGEN PADA AYAM BROILER

Penelitian ini bertujuan untuk mengetahui efektifitas penggunaan preparat kombinasi amoksisilin dan kolistin suIfat pada kasus infeksi buatan Escherichia coli pada ayam broiler. Sebanyak 140 ekor ayam broiler dipelihara sejak umur satu hari menurut pemeliharaan standar yang lazim. Pada umur 21 hari, ayam tersebut dipisahkan menjadi dua yaitu 118 ekor sebagai ayam perlakuan sedangkan sisanya 22 ekor sebagai kontrol. Ayam perlakuan diinfeksi E. coli patogenik isolat asal unggas (EC/Kls/4/02) secara intra peritoneal dosis 0,5 ml dari suspensi Mac Farland I . Segera setelah diinfeksi ayam tersebut diobati dengan preparat kombinasi amoksisilin dan kolistin dosis 1 gram per liter, diberikan selama 7 hari. Kelompok kontrol diinfeksi E. coli sebagaimana kelompok perlakuan tetapi tidak diobati. Respon pengobatan yang diamati adalah kesembuhan ayam yang teramati tanpa adanya gejala klinis, dan penampilan ayam paska pengobatan yang meliputi: rasio jumlah ayam terjual dari jumlah yang diinfeksi, berat badan dan tingkat konversi pakan. Untuk membandingkan pengaruh pengobatan antara kelompok perlakuan dan kontrol diuji dengan analisis Chi- Square menggunakan program Student Edition of Statistic 4.0 . Hasil penelitian ini menunjukkan bahwa prosentase ayam terjual sebanyak 86,4 %, dengan berat rerata pada umor 38 hari 1,48kg serta nilai efisiensipakan feed convertion ratio 1,81. Secara statistik pengaruh pengobatan tersebut terdapat perbedaan yang bermakna pada tingkat signifikasi 0,5%, antara kelompok perlakuan dan kontrol. Berdasarkan data tersebut maka dapat disimpulkan bahwa respon pengobatan pada kasus infeksi buatan E. coli menggunakan preparat kombinasi amoksisilin dan kolistin sulfat, cukup baikuntuk mengatasi infeksi tersebut. Kata kunci: Escherichia coli , kombinasi antibiotik, potensi zooteknik ayam

Isolasi dan Identifiicasi Serologis Virus Avian Influenza Dari Sampel Unggas Yang Diperoleh di D.I. Yogyakarta dan Jawa Tengah = Isolation and Serological Identification of Avian Influenza Virus From Poultry Sample ...

Avian Influenza (AI) merupakan penyakit penting pada unggas, karena dapat menyebabkan kerugian ekonomi secara signifikan, dengan tingkat morbiditas dan mortalitas penyakit sangat tinggi. L,ebih dan itu potensi penularan penyakit AI dari hewan ke manusia, memberikan dampak ekonomi tersendiri. Beberapa kasus yang diduga sebagai AI banyak mewabah di beberapa daerah di Indonesia. Penyakit tersebut cukup membingungkan peternak dan sangat dikacaukan dengan penyakit Newcastle (ND) karena kedua penyakit mempunyai kemiripan karakter dan gejala klinis. Penelitian ini bertujuan untuk mengkonfirmasi apakah wabah penyakit tersebut disebabkan oleh virus AI atau virus ND. Sampel isolasi diambil dari paru atau trakhea, kemudian diproses lebih lanjut untuk diisolasi, dipropagasi secara in ovo menggunakan telur ayam berembrio umur 9 sampai 12 hari, spesific pathogen free atau telur yang setidaknya bebas antibodi terhadap virus AI. Teknik isolasi menurut standar prosedur Office International des Epizooties (01E) dan kemungkinan adanya pertumbuhan virus diuji terhadap kemampuan mengaglutinasi sel darah merah ayam atau hemaglutinasi (HA). Uji HA positif, mengindikasikan ada pertumbuhan virus ND atau virus AL Kedua jenis virus tersebut dapat dibedakan dengan uji hemaglutinasi inhibisi (HI) menggunakan serum anti dari masing-masing virus yang diuji. Berdasarkan hasil penelitian ini dapat diambil suatu kesimpulan bahwa beberapa sampel unggas, yaitu: ayam petelur, ayam broiler, ayam kampung, dan burung puyuh, yang di peroleh dari beberapa daerah di D.I. Yogyakarta dan Jawa Tengah dan secara klinis menunjukkan gejala tersifat maupun tidak tersifat AI, secara serologis dapat dikonfirmasi sebagai virus avian influenza sub-tipe 145Ni.