Michael J. Kozal

The Effect of High-Dose Saquinavir on Viral Load and CD4+ T-Cell Counts in HIV-Infected Patients

Human immunodeficiency virus (HIV) protease inhibitors are a new class of antiretroviral agents that target a different point in the HIV life cycle than do zidovudine and other dideoxy nucleoside or non-nucleoside reverse transcriptase inhibitors. The HIV genes gag and gag-pol are translated into large polyproteins that contain the individual structural and functional HIV proteins. The HIV protease is required to cleave these polyproteins to produce infectious virus. Studies showing that the inhibition of the HIV protease resulted in the production of immature and noninfectious virus [1-3] led to the development of HIV protease inhibitors. Saquinavir is a transitional state analogue peptidomimetic inhibitor of the HIV protease [4, 5]. In vitro studies have shown that it is a potent inhibitor of HIV replication [5, 6]; preliminary clinical trials [7] have shown that it elevates CD4+ T-cell counts and suppresses viral load as measured by plasma HIV RNA levels. Pharmacokinetics studies have shown that it has low bioavailability [8]. Reported side effects are of mild to moderate intensity and include abdominal discomfort, vomiting, diarrhea, headache, and dizziness. Abnormal laboratory results have included occasional elevations in serum aminotransferase and creatinine phosphokinase levels [7]. As have patients receiving other antiretroviral agents, patients receiving protease inhibitors have had mutations in the HIV genome, and in vitro studies have suggested that phenotypic resistance results from these changes [9-13]. Mutations at codons 48 (GV) and 90 (LM) of the HIV protease gene appear to develop in the presence of saquinavir and lead to phenotypic resistance to the drug [14-16]. Mutations at other codons, such as codon 54, have also occasionally been implicated in conferring resistance to saquinavir, and increased resistance has been found when more than one mutation is present [15-17]. Resistance mutations to other protease inhibitors currently being studied in clinical trials have also been well documented [18-20]. Cross-resistance between protease inhibitors has been shown to occur in vitro [9, 20, 21]. Although some evidence suggests this may be less of a problem with saquinavir than with other protease inhibitors [9, 22], other reports have shown that saquinavir is also involved in cross-resistance [20, 21]. The clinical relevance of these mutations is not yet completely understood. Saquinavir has been licensed for use in HIV-infected patients at a dose of 1800 mg/d. Studies of saquinavir at this dose showed that it produced a median reduction of 80% in plasma HIV RNA levels and a median elevation of 50 cells/mm3 in CD4+ T-cell count, although the duration of the effect was short and values had returned nearly to baseline by week 16 [7]. Preliminary results comparing combination therapy with zidovudine plus zalcitabine, zidovudine plus saquinavir, and all three drugs together showed that the triple combination produced a more favorable response without increased toxicity [23]. Because saquinavir at a dose of 1800 mg/d had been shown to favorably influence viral load and CD4+ T-cell counts without producing severe toxicity, and because the drug has low bioavailability, it was postulated that higher doses might produce a greater antiviral effect without significantly increasing toxicity. We studied saquinavir at twice and four times the currently licensed dose to determine the efficacy, safety, and pharmacokinetics of saquinavir and to identify the optimal dose of saquinavir for future study both as monotherapy and in combination with other antiretroviral agents. Methods Persons who were positive for HIV type 1, were 18 years of age or older, had CD4+ T-cell counts of 200 to 500 cells/mm3, and had no active opportunistic infections were eligible for the study. Saquinavir was dispensed to patients as 200-mg capsules twice weekly and then once monthly. Compliance was monitored by patient report and capsule count. Toxicity Patients were initially monitored three times a week, then twice a week, and then once a month for any reported symptoms or signs of drug toxicity. Frequent laboratory testing was also done; tests included measurement of complete blood and platelet counts; serum chemistry tests; liver function tests; tests for amylase, triglyceride, and creatinine phosphokinase levels; and urinalysis. In patients with grade 3 toxicity, drug therapy was briefly discontinued and then restarted. Virology Quantitative peripheral blood mononuclear cell cultures were done by incubating serial fivefold dilutions of patient peripheral blood mononuclear cells (starting with 1 106 cells) in duplicate with 1 106 phytohemagglutin-stimulated normal peripheral blood mononuclear cells for 14 days. This was done according to the AIDS (acquired immunodeficiency syndrome) Clinical Trials Group consensus protocol for quantitative microcultures [24]. Measurements of p24 antigen levels were made for each dilution by using a commercially available p24 antigen kit (Abbott Diagnostics, Chicago, Illinois), and the results were expressed as infectious units per million peripheral blood mononuclear cells. Plasma HIV RNA levels were measured by using a previously described reverse transcriptase polymerase chain reaction (PCR) technique [25] that has been validated in a multicenter study [26]. Duplicate plasma samples were subjected to ultracentrifugation, and the pellets were extracted by using phenolchloroform. The resulting RNA pellets were reverse transcribed along with a standard curve of known RNA copy number and then amplified by PCR with gag-specific primers. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and was expressed as optical density. The standard curve was generated by plotting the number of RNA copies against the optical density, and the Equation describing the curve was used to calculate the numbers of RNA copies in the patient samples. These numbers were expressed as log RNA copies/mL of plasma. Serum p24 antigen levels were measured by Immunodiagnostic Laboratories (Hayward, California) using an enzyme-linked immunoassay system with an immune-complex disassociation step. Peripheral blood mononuclear cell viral DNA levels were measured using a previously described quantitative PCR technique [27]. Aliquots of 1 10 (6) peripheral blood mononuclear cell pellets were lysed with proteinase K, and 250 000 cell equivalents were amplified in duplicate with a standard curve of known DNA copy number. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and expressed as optical density. The standard curve was generated by plotting the number of DNA copies against optical density, and the Equation describingthe curve was used to calculate the number of DNA copies in the patient samples. These numbers were corrected for percentages of cells that are CD4 cells and expressed as log DNA copies per million CD4 cells. Immunology CD4+ T-cell counts were measured by the AIDS Clinical Trials Group-qualified flow cytometry laboratory at Stanford University Hospital. A screening measurement and two baseline measurements (obtained 2 weeks apart) were done. The average of these three results was used as the baseline value. CD4+ T-cell counts were obtained monthly at the same time that blood was drawn for virologic tests. Mutations The presence of mutations at codon 48 (GV) and 90 (LM) in the plasma of patients was determined by using a selective PCR method similar to that used for the reverse transcriptase gene [28, 29]. Cryopreserved plasma was extracted as previously described [25] and was reverse transcribed using primer TGGAGTATTGTATGGATTTTCAG (Pro1). The complementary DNA was then amplified by using PCR under standard conditions with primer CAGAGCCAACAGCCCCACCA (Pro2). Five L of the 582-base pair first-round PCR product was then amplified with primers specific for the wild-type and mutant sequences at each codon. For codon 48, primers CTTCCTTTTCCATCTCTGTA (IR48) and TGGAAACCAAAAATGACAGG (48WT) were used to determine whether a wild-type sequence was present, and IR48 and TGGAAACCAAAAATGACAGT (48MU) were used to determine whether a mutant sequence was present. For codon 90, primers GAAGCTCTATTAGATACAGG (IR90) and GTGCAACCAATCTGAGCCAA (90WT) were used to determine whether a wild-type sequence was present, and IR90 and GTGCAACCAATCTGAGCCAT (90MU) were used to determine whether a mutant sequence was present. Twenty L of the PCR product from each of the second set of PCR reactions was analyzed for genotype on 3.0% agarose gel with ethidium bromide staining. The PCR products were determined to have a mutant or wild-type sequence according to the method described by Boucher and colleagues [30, 31] and Larder and associates [28]. A sample was considered to contain the codon 48 wild-type sequence if amplification with primers IR48 and 48WT resulted in a 309-base pair product. A sample was considered to contain the codon 90 wild-type sequence if amplification with primers IR90 and 90WT resulted in a 228-base pair product. A sample was considered to contain the codon 90 mutant sequence if amplification with primers IR90 and 90MU resulted in a 228-base pair product. Samples showing bands in both the wild-type and mutant reactions were re-evaluated using 5 L of a 1:20 and 1:400 dilution of the first-round PCR product in a second-round reaction. Samples showing only a wild-type or mutant product in the dilution reactions were scored as wild-type or mutant, respectively. Samples showing both the wild-type and mutant products in the dilution reactions were considered to be mixtures. Samples in which a mixture was detected were reported as mutant for the purposes of the analysis. Patients showing a mutation at either codon 48 or codon 90 at week 24 were assayed at earlier time points to determine the timing of the appearance of the mutation. The selectiv

Low-Frequency HIV-1 Drug Resistance Mutations and Risk of NNRTI-Based Antiretroviral Treatment Failure A Systematic Review and Pooled Analysis

CONTEXT Presence of low-frequency, or minority, human immunodeficiency virus type 1 (HIV-1) drug resistance mutations may adversely affect response to antiretroviral treatment (ART), but evidence regarding the effects of such mutations on the effectiveness of first-line ART is conflicting. OBJECTIVE To evaluate the association of preexisting drug-resistant HIV-1 minority variants with risk of first-line nonnucleoside reverse transcriptase inhibitor (NNRTI)-based antiretroviral virologic failure. DATA SOURCES Systematic review of published and unpublished studies in PubMed (1966 through December 2010), EMBASE (1974 through December 2010), conference abstracts, and article references. Authors of all studies were contacted for detailed laboratory, ART, and adherence data. STUDY SELECTION AND DATA ABSTRACTION Studies involving ART-naive participants initiating NNRTI-based regimens were included. Participants were included if all drugs in their ART regimen were fully active by standard HIV drug resistance testing. Cox proportional hazard models using pooled patient-level data were used to estimate the risk of virologic failure based on a Prentice weighted case-cohort analysis stratified by study. DATA SYNTHESIS Individual data from 10 studies and 985 participants were available for the primary analysis. Low-frequency drug resistance mutations were detected in 187 participants, including 117 of 808 patients in the cohort studies. Low-frequency HIV-1 drug resistance mutations were associated with an increased risk of virologic failure (hazard ratio (HR], 2.3 [95% confidence interval {CI}, 1.7-3.3]; P < .001) after controlling for medication adherence, race/ethnicity, baseline CD4 cell count, and plasma HIV-1 RNA levels. Increased risk of virologic failure was most strongly associated with minority variants resistant to NNRTIs (HR, 2.6 [95% CI, 1.9-3.5]; P < .001). Among participants from the cohort studies, 35% of those with detectable minority variants experienced virologic failure compared with 15% of those without minority variants. The presence of minority variants was associated with 2.5 to 3 times the risk of virologic failure at either 95% or greater or less than 95% overall medication adherence. A dose-dependent increased risk of virologic failure was found in participants with a higher proportion or quantity of drug-resistant variants. CONCLUSION In a pooled analysis, low-frequency HIV-1 drug resistance mutations, particularly involving NNRTI resistance, were significantly associated with a dose-dependent increased risk of virologic failure with first-line ART.

A comparison of three highly active antiretroviral treatment strategies consisting of non-nucleoside reverse transcriptase inhibitors, protease inhibitors, or both in the presence of nucleoside reverse transcriptase inhibitors as initial therapy (CPCRA 058 FIRST Study): a long-term randomised trial

BACKGROUND Long-term data from randomised trials on the consequences of treatment with a protease inhibitor (PI), non-nucleoside reverse transcriptase inhibitor (NNRTI), or both are lacking. Here, we report results from the FIRST trial, which compared initial treatment strategies for clinical, immunological, and virological outcomes. METHODS Between 1999 and 2002, 1397 antiretroviral-treatment-naive patients, presenting at 18 clinical trial units with 80 research sites in the USA, were randomly assigned in a ratio of 1:1:1 to a protease inhibitor (PI) strategy (PI plus nucleoside reverse transcriptase inhibitor [NRTI]; n=470), a non-nucleoside reverse transcriptase inhibitor (NNRTI) strategy (NNRTI plus NRTI; n=463), or a three-class strategy (PI plus NNRTI plus NRTI; n=464). Primary endpoints were a composite of an AIDS-defining event, death, or CD4 cell count decline to less than 200 cells per mm3 for the PI versus NNRTI comparison, and average change in CD4 cell count at or after 32 months for the three-class versus combined two-class comparison. Analyses were by intention-to-treat. This study is registered ClinicalTrials.gov, number NCT00000922. FINDINGS 1397 patients were assessed for the composite endpoint. A total of 388 participants developed the composite endpoint, 302 developed AIDS or died, and 188 died. NNRTI versus PI hazard ratios (HRs) for the composite endpoint, for AIDS or death, for death, and for virological failure were 1.02 (95% CI 0.79-1.31), 1.07 (0.80-1.41), 0.95 (0.66-1.37), and 0.66 (0.56-0.78), respectively. 1196 patients were assessed for the three-class versus combined two-class primary endpoint. Mean change in CD4 cell count at or after 32 months was +234 cells per mm3 and +227 cells per mm3 for the three-class and the combined two-class strategies (p=0.62), respectively. HRs (three-class vs combined two-class) for AIDS or death and virological failure were 1.15 (0.91-1.45) and 0.87 (0.75-1.00), respectively. HRs (three-class vs combined two-class) for AIDS or death were similar for participants with baseline CD4 cell counts of 200 cells per mm3 or less and of more than 200 cells per mm3 (p=0.38 for interaction), and for participants with baseline HIV RNA concentrations less than 100 000 copies per mL and 100,000 copies per mL or more (p=0.26 for interaction). Participants assigned the three-class strategy were significantly more likely to discontinue treatment because of toxic effects than were those assigned to the two-class strategies (HR 1.58; p<0.0001). INTERPRETATION Initial treatment with either an NNRTI-based regimen or a PI-based regimen, but not both together, is a good strategy for long-term antiretroviral management in treatment-naive patients with HIV.

Prevalence of Antiretroviral Drug Resistance Mutations in Chronically HIV–Infected, Treatment-Naive Patients: Implications for Routine Resistance Screening before Initiation of Antiretroviral Therapy

BACKGROUND The prevalence of drug resistance among persons with newly acquired human immunodeficiency virus (HIV) infection is well documented. However, it is unclear to what extent these mutations persist in chronically infected, treatment-naive patients. METHODS Prevalence of and factors associated with genotypic drug resistance were analyzed retrospectively in a subset of 491 chronically HIV-infected, antiretroviral-naive patients enrolled at 25 cities in the Terry Beirn Community Programs for Clinical Research on Acquired Immune Deficiency Syndrome (AIDS) Flexible Initial Retrovirus Suppressive Therapies trial during 1999-2001. Resistance was defined on the basis of the International AIDS Society 2003 definition, as well as the presence of additional mutations at codons 215 (C/D/E/S) and 69 (A/N/S) in the pol gene. Prevalence of mutations was estimated by use of techniques for stratified random samples. Logistic regression models were used to determine factors associated with resistance. RESULTS Among the 491 chronically HIV-infected patients (mean CD4 cell count, 269 cells/mm(3); 31% of patients had a prior AIDS diagnosis), 57 (11.6%) had >or=1 resistance mutation, resulting in an estimated prevalence for the cohort of 10.8% (95% confidence interval [CI], 9.5%-12.1%). The prevalence was 8.8% if the 118I mutation was excluded. By drug class, the estimated prevalence of mutations conferring resistance to nucleoside reverse-transcriptase inhibitors was 7.8%, and the prevalence was 3.0% for nonnucleoside reverse-transcriptase inhibitors and 0.7% for protease inhibitors. In a multiple logistic regression analysis, non-Hispanic white subjects were twice as likely than African American subjects to have resistance (odds ratio [OR], 2.1; 95% CI, 1.1-4.1; P=.03), and there was a 40% increase per year in prevalence of mutations by later year of enrollment (OR, 1.4; 95% CI, 1.0-2.1; P=.05). CONCLUSIONS These results demonstrate the persistence of drug resistance mutations in chronically HIV-infected patients and an increasing prevalence of resistance over time, and they support genotyping of virus at baseline for chronically HIV-infected patients.

Adherence, virological and immunological outcomes for HIV-infected veterans starting combination antiretroviral therapies

Objectives:We aimed to determine adherence, virological, and immunological outcomes one year after starting a first combination antiretroviral therapy (ART) regimen. Design:Observational; synthesis of administrative, laboratory, and pharmacy data. Antiretroviral regimens were divided into efavirenz, nevirapine, boosted protease inhibitor (PI), and single PI categories. Propensity scores were used to control for confounding by treatment assignment. Adherence was estimated from pharmacy refill records. Setting:Veterans Affairs Healthcare System, all sites. Participants:HIV-infected individuals starting combination ART with a low likelihood of previous antiretroviral exposure. Interventions:None. Outcomes:The proportion of antiretroviral prescriptions filled as prescribed, a change in log HIV-RNA, the proportion with log HIV-RNA viral suppression, a change in CD4 cell count. Results:A total of 6394 individuals unlikely to have previous antiretroviral exposure started combination ART between 1996 and 2004, and were eligible for analysis. Adherence overall was low (63% of prescriptions filled as prescribed), and adherence with efavirenz (67%) and nevirapine (65%) regimens was significantly greater than adherence with boosted PI (59%) or single PI (61%) regimens (P < 0.001). Efavirenz regimens were more likely to suppress HIV-RNA at one year (74%) compared with nevirapine (62%), boosted PI (63%), or single PI (53%) regimens (all P < 0.001), and this superiority was maintained when analyses were adjusted for baseline clinical characteristics and propensity for treatment assignment. Efavirenz also yielded more favorable immunological outcomes. Conclusion:HIV-infected individuals initiating their first combination ART using an efavirenz-based regimen had improved virological and immunological outcomes and greater adherence levels.

Prevalence and Clinical Significance of HIV Drug Resistance Mutations by Ultra-Deep Sequencing in Antiretroviral-Naive Subjects in the CASTLE Study

Background CASTLE compared the efficacy of atazanavir/ritonavir with lopinavir/ritonavir, each in combination with tenofovir-emtricitabine in ARV-naïve subjects from 5 continents. Objectives Determine the baseline rate and clinical significance of TDR mutations using ultra-deep sequencing (UDS) in ARV-naïve subjects in CASTLE. Methods A case control study was performed on baseline samples for all 53 subjects with virologic failures (VF) at Week 48 and 95 subjects with virologic successes (VS) randomly selected and matched by CD4 count and viral load. UDS was performed using 454 Life Sciences/Roche technology. Results Of 148 samples, 141 had successful UDS (86 subtype B, 55 non-B subtypes). Overall, 30.5% of subjects had a TDR mutation at baseline; 15.6% only had TDR(s) at <20% of the viral population. There was no difference in the rate of TDRs by B (30.2%) or non-B subtypes (30.9%). VF (51) and VS (90) had similar rates of any TDRs (25.5% vs. 33.3%), NNRTI TDRs (11.1% vs.11.8%) and NRTI TDRs (24.4% vs. 25.5%). Of 9 (6.4%) subjects with M184V/I (7 at <20% levels), 6 experienced VF. 16 (11.3%) subjects had multiple TAMs, and 7 experienced VF. 3 (2.1%) subjects had both multiple TAMs+M184V, and all experienced VF. Of 14 (9.9%) subjects with PI TDRs (11 at <20% levels): only 1 experienced virologic failure. The majority of PI TDRs were found in isolation (e.g. 46I) at <20% levels, and had low resistance algorithm scores. Conclusion Among a representative sample of ARV-naïve subjects in CASTLE, TDR mutations were common (30.5%); B and non-B subtypes had similar rates of TDRs. Subjects with multiple PI TDRs were infrequent. Overall, TDRs did not affect virologic response for subjects on a boosted PI by week 48; however, a small subset of subjects with extensive NRTI backbone TDR patterns experienced virologic failure.

A nucleoside- and ritonavir-sparing regimen containing atazanavir plus raltegravir in antiretroviral treatment-naïve HIV-infected patients: SPARTAN study results.

Abstract Background: Nucleoside and ritonavir (RTV) toxicities have led to increased interest in nucleoside reverse transcriptase inhibitors (NRTIs) and RTV-sparing antiretroviral regimens. SPARTAN was a multicenter, randomized, open-label, noncomparative pilot study evaluating the efficacy, safety, and resistance profile of an investigational NRTI- and RTV-sparing regimen (experimental atazanavir [ATV] dose 300 mg bid + raltegravir [RAL] 400 mg bid [ATV+RAL]). The reference regimen consisted of ATV 300 mg/RTV 100 mg qd + tenofovir (TDF) 300 mg/emtricitabine (FTC) 200 mg qd (ATV/r+TDF/FTC). Methods: Treatment-naïve HIV-infected patients with HIV-RNA ≥5,000 copies/mL were randomized 2:1 to receive twice-daily ATV+RAL (n=63) or once-daily ATV/r+TDF/FTC (n=31). Efficacy at 24 weeks was determined by confirmed virologic response (CVR; HIV-RNA <50 copies/mL) with noncom-pleters counted as failures based on all treated subjects. Results: The proportion of patients with CVR HIV RNA <50 copies/mL at week 24 was 74.6% (47/63) in the ATV+RAL arm and 63.3% (19/30) in the ATV/r+TDF/FTC arm. Systemic exposure to ATV in the ATV+RAL regimen was higher than historically observed with ATV/r+TDF/ FTC. Incidence of Grade 4 hyperbilirubinemia was higher on ATV+RAL (20.6%; 13/63) than on ATV/r+TDF/FTC (0%). The criteria for resistance testing (virologic failure [VF]: HIV-RNA ≥400 copies/mL) was met in 6/63 patients on ATV+RAL, and 1/30 on ATV/r+TDF/FTC; 4 VFs on ATV+RAL developed RAL resistance. Conclusions: ATV+RAL, an experimental NRTI- and RTV-sparing regimen, achieved virologic suppression rates comparable to current standards of care for treatment-naïve patients. The overall profile did not appear optimal for further clinical development given its development of resistance to RAL and higher rates of hyperbilirubinemia with twice-daily ATV compared with ATV/RTV.

Didanosine resistance in HIV-infected patients switched from zidovudine to didanosine monotherapy

Clinical benefit from zidovudine therapy in patients infected with human immunodeficiency virus (HIV) is short-lived. Patients treated with zidovudine ultimately progress to the acquired immunodeficiency syndrome (AIDS), and strains of HIV resistant to zidovudine eventually develop while patients are receiving the drug [1]. Kahn and colleagues [2] reported that patients infected with HIV who have relatively advanced disease and at least 16 weeks of previous zidovudine therapy may have clinical benefit if switched to didanosine monotherapy instead of remaining on zidovudine. The reason patients benefit from switching from zidovudine to didanosine is not fully understood, but one possibility is that didanosine suppresses zidovudine-resistant HIV. Increasing evidence exists of a correlation between zidovudine-resistant HIV and disease progression in patients treated with zidovudine monotherapy [3-8]. It has been shown that HIV can also develop resistance to didanosine [9-11]. As with the resistance of HIV to zidovudine, the decrease in susceptibility of HIV to didanosine has been shown to be caused by specific mutations in the HIV reverse-transcriptase gene. St. Clair and colleagues [9] identified the first mutation in the reverse-transcriptase gene to confer resistance to didanosine, a mutation at codon 74 that results in an amino acid change from leucine to valine. The codon 74 mutation in an HIV construct can induce an eightfold decrease in susceptibility to didanosine [9]. Although other mutations have been reported to confer didanosine resistance [12], most data to date suggest that the codon 74 mutation is the primary mutation responsible for didanosine resistance in patients receiving didanosine monotherapy [9, 13-16]. Researchers have postulated [17, 18] that genotypic assays that can detect HIV reverse-transcriptase mutations may be used in place of drug susceptibility testing when a proven association exists between a specific mutation and drug resistance. Previously we reported [5] that in patients who are receiving zidovudine monotherapy, the development of a serum HIV RNA mutation at codon 215 (which confers a 16-fold decrease in susceptibility to zidovudine [18]) was strongly associated with and predictive of decreases in CD4+ T cells in these patients. In the current study, we obtained serum HIV RNA from patients who were switched from zidovudine to didanosine therapy, and we examined the relation of the codon 74 mutation in patient serum HIV RNA to changes in CD4+ T-cell levels and HIV virus burden. The development of the codon 74 mutation in relation to the genotype at codon 215 was also examined because researchers have shown that the combination of codon 215 and codon 74 mutations can restore HIV susceptibility to zidovudine [9] and that the preexistence of zidovudine resistance mutations may actually augment didanosine resistance [9, 13, 14]. Methods Patients Sixty-four patients infected with HIV were enrolled in three protocols at Stanford University Medical Center: 1) Eight patients were enrolled in Stanford University/San Mateo County Didanosine Protocol [19], an open-labeled study involving patients who had received zidovudine [Retrovir; Burroughs Wellcome, Research Triangle Park, North Carolina] for more than 16 months who were switched to didanosine; 2) 33 patients were enrolled in AIDS Clinical Trial Group Protocols [2] 116b/117 who had tolerated zidovudine for at least 16 weeks and were then switched to didanosine; and 3) 23 patients were enrolled in AIDS Clinical Trial Group Protocol 118 who were intolerant to zidovudine and who had been switched to didanosine. The baseline CD4+ T-cell counts of the patients ranged from 6 to 400 CD4+ T cells/mm3 (median, 105 CD4+ cells/mm3), and patients had either AIDS, AIDS-related complex, or were asymptomatic. No patient had an active opportunistic infection at the time of enrollment in the study, and patients received Pneumocystis carinii prophylaxis as defined by each protocol and were allowed to continue suppressive therapy for previously diagnosed opportunistic infections [2, 19]. Patients received didanosine (Videx; Bristol Laboratories, Princeton, New Jersey) monotherapy at one of three possible dosages: 200 mg/d (6 patients), 500 mg/d (31 patients), or 750 mg/d (27 patients). Serial serum samples were saved at week 0, 2, 8, 12, 16, 24, 32, 40, and 48; at these same time points, CD4+ T-cell determinations were done. All patients were followed until the close of study or until death. Reverse-Transcriptase Gene Mutational Analysis Cryopreserved (70C) serum was thawed and 200 L was ultracentrifuged at 125 000 g for 10 minutes. The resulting pellet was dissolved in 400 L of 5-M guanidium thiocyanate. Serum HIV RNA was then extracted as previously described [20-22]. Extracted viral RNA was then reverse-transcribed to cDNA using 500 ng of primer 35-NE1 [17] and 5 units of murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, Maryland) with reaction conditions and controls as previously described [5, 16]. The cDNA was amplified by PCR using 250 ng of primer 35-A [17] with the reaction conditions described by Larder and Boucher and colleagues [17, 18]. For selective PCR, 5 L of the 805-basepair product from the first PCR was used in the second series of reactions. Primers 3W (wild type), 3M (mutant), and B [17, 18] were used to determine the sequence at codon 215; primers X2 and 74WT (wild type) and 74M (mutant) [9, 16] were used to determine the sequence at codon 74. Master mix, negative, wild-type, and mutant sequenced controls were amplified in each sample run. Non-reverse-transcribed control samples subjected to the PCR procedure yielded negative results, and patient RNA samples treated with deoxyribonuclease yielded identical results to patient RNA samples using our extraction procedure, validating that the reverse-transcriptase PCR product was the result of HIV RNA and not DNA. The purity of the extracted RNA using the guanidium thiocyanate-phenol-chloroform extraction technique has been previously reported by Chomczynski and Sacchi [22]. Fifteen HIV isolates that had been tested in our laboratory by nested PCR for the codon 74 and 215 mutations were also sequenced and confirmed the presence or absence of these mutations. Products from PCR were analyzed on a 3% agarose gel with ethidium bromide staining. All samples had been blinded by a code number from the start and thus the evaluator who scored the PCR product had no knowledge of sample origin (that is, the corresponding patient). Samples yielding a product with only the wild-type primers were considered wild type. Samples that yielded product with only the mutant primers were considered mutant. If a sample yielded product with wild-type and mutant primers, the second PCR step was repeated with serial dilutions of the first round PCR (at dilutions of 1:20, 1:400, and 1:8000); if a mixture of wild type and mutant was still present after serial dilutions, the sample was considered a mixture of wild-type and mutant sequences at the codon of interest. Samples with a mixture of wild-type and mutant sequences at the codon were included in the mutant group in our statistical analysis. Serum HIV RNA Preparation for Virus Burden Duplicate serum samples were ultracentrifuged, and the pellet was purified by phenol-chloroform extraction and alcohol precipitation, as previously described for plasma [20]. Polymerase chain reaction quantification of viral RNA was done using reverse-transcriptase PCR, and the PCR product was detected using a nonisotopic enzyme hybridization assay, as previously described [20, 21]. Results were then expressed as HIV RNA copies per milliliter of serum. HIV Biological Phenotype For the 25 patients for whom cryopreserved peripheral blood mononuclear cells were available, viral stocks were created from these mononuclear cells by cocultivation with peripheral blood mononuclear cells from patients who were seronegative for HIV. Viral stock supernatant (the tissue culture infective dose50 was about 2000), 200 L, was cultured with 8 mL of MT-2 cells (0.5 106 cells/mL) in duplicate. Cultures were maintained for 3 weeks and were examined for syncytia twice a week, as described by Koot and colleagues [23]. CD4+ Cell Counts CD4+ cell counts were done at weeks 0, 2, 4, 8, 12, 16, 24, 32, 40, and 48 by the Stanford University Blood Bank (a certified member of the National Institute of Allergy and Infectious Diseases, Division of AIDS, the CD4+ T-cell quality assurance program for the AIDS Clinical Trial Group). Statistical Analysis A two-sided t-test was used to compare changes in virus burden between patient groups. A standard one-sample, two-sided Wilcoxon test was used to compare differences in the change of slopes of CD4+ T cells (slopes of CD4+ cells before the mutation compared with slopes of CD4+ cells after the mutation) for patients developing a mutation at codon 74. The slope difference test analysis pertained to the slope difference statistic, defined to be the difference in fitted slope of the CD4+ counts after compared with before the mutation at codon 74. Thirty-four of 38 patients in the mutation group had sufficient data to allow computation of the slope difference statistic. We compared the slope difference statistic values for the 34 mutants with the corresponding values from the wild-type group in order to see if they were more negative in the mutant group. This is not possible directly because the wild-type group by definition has no mutation time from which to define before and after. Instead, artificial slope difference values were constructed as follows: 1) a random participant was chosen from the 25 in the wild-type group; 2) a random mutation time was chosen from the 38 such times in the mutation group; and 3) if the mutation time was less than the last observation time for the randomly selected participant, then the wild-typ

Relationship between minority nonnucleoside reverse transcriptase inhibitor resistance mutations, adherence, and the risk of virologic failure.

Objectives:To evaluate the risk of virologic failure conferred by suboptimal adherence to nonnucleoside reverse transcriptase inhibitors (NNRTIs) and minority NNRTI resistance mutations. Design:Pooled analysis of the risk of virologic failure conferred by minority NNRTI resistance mutations and NNRTI adherence from three studies of treatment-naïve individuals initiating an NNRTI-based regimen. Methods:Participants from each study were categorized into both adherence quartiles (Q1–Q4) and four strata: at least 95%, 80–94%, 60–79%, and below 60%. Weighted Cox proportional hazard models were used to estimate the risk of virologic failure. Results:The majority of participants (N = 768) had high measured adherence, but those in the lowest adherence quartile had the highest proportion of participants with virologic failure and the risk of virologic failure increased step-wise with adherence below 95%. Detection of minority NNRTI drug resistance mutations increased the proportion of participants with virologic failure across adherence quartiles (Cochran–Mantel–Haenszel P < 0.001) and adherence strata [Cochran–Mantel–Haenszel P < 0.001; <60% adherence, hazard ratio 1.7 (1.1–2.7), P = 0.02; 60–79% adherence, hazard ratio 1.2 (0.5–3.2), P = 0.67; 80–94% adherence, hazard ratio 2.5 (0.98–6.3), P = 0.06; ≥95% adherence, hazard ratio 3.6 (2.3–5.6), P < 0.001]. On multivariate analysis, the effect of minority variants was also most prominent at higher levels of medication adherence. Conclusions:The presence of minority NNRTI resistance mutations and NNRTI adherence were found to be independent predictors of virologic failure, but also modify each others effects on virologic failure. In addition to the focus on medication adherence counseling, ultrasensitive HIV-1 drug resistance assays could play a role in optimizing the success rates of first-line antiretroviral therapy.

Antiretroviral resistance and high-risk transmission behavior among HIV-positive patients in clinical care.

Background: HIV-positive patients receiving antiretroviral therapy (ART) who engage in HIV transmission behaviors may harbor and transmit drug-resistant HIV. However, little is known about the risk behaviors of these patients, potential partners exposed and the relationship of these to ART resistance. Objective: To determine the relationship of HIV drug resistance and continuing HIV transmission risk behavior among HIV-positive patients in care. Methods: A retrospective, cross-sectional study of HIV transmission risk behavior and HIV drug resistance data from 333 HIV-positive patients. Results: Among a diverse population of 333 HIV-positive patients, 75 (23%) had unprotected sex during the previous 3-months, resulting in 1126 unprotected sexual events with 191 partners of whom 155 were believed by patients to be HIV-negative or of unknown status. Eighteen of the 75 (24%) had resistant HIV and 207 unprotected sexual events, exposing 18% of the HIV- or status unknown partners. There was no difference in the proportion of patients engaging in unprotected sex who had undetectable viral load (VL) (22%): VL > 400 copies/ml without resistance (20%) and VL > 400copies/ml with resistance (26%). Resistance and risk behavior was predicted only by lower mental health scores (odds ratio, 10.3; 95% confidence interval, 1.7–18.6). Conclusion: A substantial minority (23%) of patients in clinical care engaged in HIV sexual transmission risk behavior. A small subset of these also had ART-resistant HIV. However, this core group (approximately 5% of all patients) accounted for a large number of high-risk HIV transmission events with resistant virus, exposing a substantial number of partners.