Michael K. Liem

Lacunar Infarcts Are the Main Correlate With Cognitive Dysfunction in CADASIL

Background and Purpose— Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy is caused by mutations in the NOTCH3 gene and is clinically characterized by recurrent stroke and cognitive decline. Previous studies have shown an association between white matter hyperintensities on brain MRI and cognitive dysfunction in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. In the general population the presence of lacunar infarcts and microbleeds is also associated with cognitive dysfunction. The objective of this study was to determine to what extent lacunar infarcts and microbleeds on MRI contribute to cognitive decline in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Methods— NOTCH3 mutation analysis was performed in 62 symptomatic and asymptomatic members of 15 cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy families. Neuropsychological tests were performed on the same day as the MRI examination. MRI was semi-quantitatively scored for white matter hyperintensities, infarct lesion load, and microbleeds. Regression analysis was performed to test the association between MRI abnormalities and neuropsychological test results. Results— Forty individuals had a NOTCH3 mutation and 22 did not. Severity of cognitive dysfunction in mutation carriers was independently associated with MRI infarct lesion load (P<0.05). In contrast, WMH lesion load and microbleeds were not associated with cognitive dysfunction after correcting for age. Conclusions— Lacunar infarct lesion load is the most important MRI parameter associated with cognitive dysfunction in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy.

MRI correlates of cognitive decline in CADASIL: a 7-year follow-up study.

Background: Cognitive decline is one of the clinical hallmarks of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), a cerebrovascular disease caused by NOTCH3 mutations. In this 7-year follow-up study, we aimed to determine whether there are associations between the different radiologic hallmarks in CADASIL and decline in specific cognitive domains. Methods: Twenty-five NOTCH3 mutation carriers and 13 controls had standardized neuropsychological testing and MRI examinations at baseline and after a follow-up of 7 years. To identify longitudinal associations between MRI abnormalities and cognitive decline, correlation analysis was used. Results: At follow-up, mutation carriers showed a decline in global cognitive function (CAMCOG, p < 0.01) and in the cognitive domains language, memory, and executive function, compared to controls. Cognitive decline, especially executive dysfunction, was associated with increase in lacunar infarcts, microbleeds, and ventricular volume. In contrast, WMHs and brain atrophy were not associated with cognitive decline. Conclusion: Increase in lacunar infarcts, microbleeds, and ventricular volume, but not white matter lesions or atrophy, are associated with cognitive decline in the process of CADASIL in younger-aged, mildly affected patients with CADASIL.

CADASIL and migraine: A narrative review

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is caused by mutations in the NOTCH3 gene and is clinically characterized by recurrent stroke, cognitive decline, psychiatric disturbances and migraine. The prevalence of migraine in CADASIL is slightly higher than in the general population, and the proportion of migraine with aura is much higher. The pathophysiological mechanism that leads to increased aura prevalence in CADASIL is unknown. Possible mechanisms of the excess of migraine with aura are an increased susceptibility to cortical spreading depression (CSD) or a different expression of CSD. It is also possible that the brainstem migraine area is involved in CADASIL. Last, it is possible that the NOTCH3 mutation acts as a migraine aura susceptibility gene by itself. In this narrative review we summarize the literature about migraine in CADASIL, with a special focus on what CADASIL might teach us about the pathophysiology of migraine.

Hypomorphic NOTCH3 alleles do not cause CADASIL in humans.

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is caused by stereotyped missense mutations in NOTCH3. Whether these mutations lead to the CADASIL phenotype via a neomorphic effect, or rather by a hypomorphic effect, is subject of debate. Here, we report two novel NOTCH3 mutations, both leading to a premature stop codon with predicted loss of NOTCH3 function. The first mutation, c.307C>T, p.Arg103*, was detected in two brothers aged 50 and 55 years, with a brain MRI and skin biopsy incompatible with CADASIL. The other mutation was found in a 40‐year‐old CADASIL patient compound heterozygous for a pathogenic NOTCH3 mutation (c.2129A>G, p.Tyr710Cys) and an intragenic frameshift deletion. The deletion was inherited from his father, who did not have the skin biopsy abnormalities seen in CADASIL patients. These individuals with rare NOTCH3 mutations indicate that hypomorphic NOTCH3 alleles do not cause CADASIL.

Cerebrovascular Reactivity Is a Main Determinant of White Matter Hyperintensity Progression in CADASIL

BACKGROUND AND PURPOSE: Basal total cerebral blood flow (TCBF) and cerebrovascular reactivity (CVR) are assumed to play an important role in the pathophysiology of small-vessel disease. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a unique monogenetic model to study the pathophysiology of arterial small-vessel disease. The aim of this study was to investigate the role of TCBF and CVR in the progression of MR imaging abnormalities in CADASIL. MATERIALS AND METHODS: Basal TCBF was measured in 25 NOTCH3 mutation carriers and 13 control subjects at baseline. CVR after administration of acetazolamide was measured in 14 NOTCH3 mutation carriers and 9 control subjects. Increase in white matter hyperintensities (WMHs), lacunar infarcts, and microbleeds on MR imaging was measured 7 years later. RESULTS: Lower CVR at baseline was associated with larger increase of WMHs (P = .001) but not with a larger increase of lacunar infarcts or microbleeds. TCBF at baseline was not associated with an increase of MR imaging abnormalities. CONCLUSIONS: Decreased CVR is a potential predictor of disease progression as indicated by increasing WMHs in CADASIL.

Homozygosity for a NOTCH3 mutation in a 65-year-old CADASIL patient with mild symptoms

JO N 3 03 6 tient with a homozygous NOTCH3 mutation has been reported to date [10]. This patient’s phenotype was at the severe end of the clinical spectrum. The question thus remains whether this dominantly inherited disease is aggravated by a homozygous mutation. To answer this question, we studied a Dutch female patient with a homozygous NOTCH3 mutation and compared the clinical findings to a brother with a heterozygous mutation and a sister without a mutation. A full clinical history was taken. MRI examination was performed on a 3 Tesla scanner using axial T1, T2, FLAIR and T2*-GE sequences. The number of lacunar infarcts and microbleeds were counted manually and WMH volume was measured using semi-automated segmentation software [1]. Additional DTI and MR spectroscopy analyses were performed in an area of normal appearing white matter in the centrum semiovale. Neuropsychological testing was performed using a standardized protocol [9]. NOTCH3 mutation scanning was performed by direct sequence analysis, according to previously described techniques [6]. Two sets of forward and reverse primers (N3ex11F1 (5’-ATTGGTCCGAGGCCTCACTT ) – N3ex11R2 (5’CCATTCCCAACCCCTCTGTG) and N3ex11F2 (5’-TGCCTGTGCTCCTGGCTACA) – N3ex12R1 (5’-TCTCATGGCAGCCACTTGCC)) were used to rule out preferential amplification of the mutant allele due to polymorphisms in the primer binding site. We used Multiplex Ligation-dependent Probe Amplification (MLPA) to rule out that one of the NOTCH3 alleles was deleted [8]. The 65-year-old female patient had a homozygous missense mutation of the NOTCH3 gene in exon 11: c.C1732T resulting in a p.ArgMichael K. Liem Saskia A. J. Lesnik Oberstein Magdalena J. Vollebregt Huub A. M. Middelkoop Jeroen van der Grond Apollonia T. J. M. Helderman-van den Enden

Cortical phase changes in Alzheimer's disease at 7T MRI: A novel imaging marker

Postmortem studies have indicated the potential of high‐field magnetic resonance imaging (MRI) to visualize amyloid depositions in the cerebral cortex. The aim of this study is to test this hypothesis in patients with Alzheimers disease (AD).

7 T MRI reveals diffuse iron deposition in putamen and caudate nucleus in CADASIL

Objective Diffuse iron deposition in the brain is commonly found in older people. One of the possible mechanisms that contribute to this iron deposition is cerebral small vessel disease. The aim of this study is to quantify diffuse iron deposition in patients with the hereditary small vessel disease cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). Methods 25 NOTCH3 mutation carriers and 18 healthy controls were examined using high-resolution T2*-weighted imaging on a 7 T whole body MRI scanner. Susceptibility-weighted MRI scans were analysed for areas of signal loss and increased phase shift. Phase shift measurements in deep grey nuclei, cortex and subcortical white matter were compared between mutation carriers and controls. For confirmation, ex vivo brain specimens from another three patients with CADASIL were analysed for iron deposition using ex vivo MRI combined with iron histochemistry. Results In vivo MRI showed areas of decreased signal intensity and increased phase shift in mutation carriers. Compared with healthy controls, mutation carriers had significantly higher phase shift in the putamen (p=0.0002) and caudate nucleus (p=0.006). Ex vivo MRI showed decreased signal intensity in the putamen and caudate nucleus in all specimens. Histochemistry confirmed the presence of iron deposition in these nuclei. Conclusions This study demonstrates increased diffuse iron accumulation in the putamen and caudate nucleus in patients with the small vessel disease CADASIL. This supports the hypothesis that small vessel disease contributes to the process of increased iron accumulation in the general population.

Lenticulostriate Arterial Lumina Are Normal in Cerebral Autosomal-Dominant Arteriopathy With Subcortical Infarcts and Leukoencephalopathy: A High-Field In Vivo MRI Study

Background and Purpose— Cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a hereditary small vessel disease. Although postmortem studies have demonstrated mural thickening in leptomeningeal arteries and lenticulostriate perforating arteries, it is unclear whether this also leads to luminal narrowing. High-field MRI scanners enable in vivo imaging of the lumen of the lenticulostriate arteries. The aim of this study is to examine the luminal diameters of lenticulostriate arteries in living patients with CADASIL and to investigate whether luminal narrowing is correlated with the number of lacunar infarcts in the basal ganglia. Methods— Twenty-two NOTCH3 mutation carriers and 11 healthy control subjects were examined using high-resolution 3-dimensional time-of-flight MR angiography imaging on a 7-T MRI scanner. Scans were analyzed for the presence of focal stenotic segments. The total number, length, and total cross-sectional area of lenticulostriate arteries were measured and compared between mutation carriers and control subjects. These measurements were correlated with age, disease duration, and number of lacunar infarcts in the basal ganglia. Results— No stenotic segments were observed. No differences between mutation carriers and control subjects were found in total number of end branches (mutation carriers: mean, 14.6; control subjects: mean, 12.8), length of the lenticulostriate system, or total cross-sectional area of lenticulostriate artery lumina. Measurements of lenticulostriate artery lumina were not associated with lacunar infarct load in the basal ganglia area or with basal ganglia hyperintensities. Conclusions— Three-dimensional time-of-flight MR angiographic on 7 T showed no differences in luminal diameters of lenticulostriate arteries between patients with CADASIL and control subjects.

Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy: Progression of MR Abnormalities in Prospective 7-year Follow-up Study

PURPOSE To prospectively investigate the patterns and rates of progression of magnetic resonance (MR) imaging abnormalities in a well-documented cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) cohort 7 years after baseline and to identify the prognostic factors that determine the rates and patterns of this progression. MATERIALS AND METHODS The local ethics committee approved the study, and informed consent was obtained from all participants. From 12 unrelated families, 25 patients who were NOTCH3 mutation carriers and 13 who were non-mutation carriers were examined clinically and with standardized MR imaging at baseline and after 7 years. The progression of white matter hyperintensities (WMHs), lacunar infarcts, microbleeding, and brain volume loss was measured semiquantitatively. Correlation testing and group comparison testing were performed to identify the risk factors associated with increased progression of CADASIL-related MR abnormalities. RESULTS Compared with the non-mutation carriers, the mutation carriers showed significant increases in numbers of lacunar infarct (P < .01), WMH (P < .01), and microbleed (P < .05) lesions but no increased loss of brain volume. The distributions of new WMHs and new lacunar infarcts at follow-up were similar to the distributions of these abnormalities at baseline. High WMH (P < .05), lacunar infarct (P < .01), and microbleed (P < .01) lesion loads at baseline--but not cardiovascular risk factors--were associated with faster progression of these abnormalities. CONCLUSION Patients with CADASIL who have a high MR abnormality lesion load at baseline are at risk for faster progression of MR abnormalities.