Michaela Beese

Aldosterone Modulates Endothelial Permeability and Endothelial Nitric Oxide Synthase Activity by Rearrangement of the Actin Cytoskeleton

Aldosterone (Aldo) is involved in vascular remodeling and inflammation; however, the mechanisms are imperfectly defined. We hypothesized that Aldo alters endothelial integrity and modifies paracellular permeability. Human umbilical vein endothelial cells were exposed to Aldo (10–9 mol/L) and alterations in paracellular permeability, assembly of tight and adherens junctions and activation of intracellular signaling pathways were determined. Aldo increased endothelial permeability for molecules ⩽70 kDa within 60 minutes. A transient loss of cortical actin with formation of actin stress fibers and disruption of continuous adherens and tight junction strands accompanied these changes. Mineralocorticoid receptor blockade, inhibition of RhoA, or disruption of extracellular-regulated protein kinase1/2 signaling pathways attenuated the Aldo-related effects. Moreover, Aldo-induced cytoskeletal rearrangement led to rapid dephosphorylation of protein kinase B and subsequent deactivation of endothelial nitric oxide synthase. Ex vivo tracer flux experiments with Evans blue–conjugated albumin demonstrated a concordant response to Aldo in freshly isolated umbilical arteries. Furthermore, low-dose cortisol (3×10–10 to 3×10–9 mol/L) mimics the effect of Aldo on endothelial integrity, and Aldo, by upregulating11&bgr;-hydroxysteroid dehydrogenase type 2, might even aggravate this deleterious effect of low-dose cortisol. We suggest that these mechanisms may contribute to the vasculopathy induced by inappropriate mineralocorticoid receptor activation.

Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis

ANCA-associated vasculitides are characterized by inflammatory destruction of small vessels accompanied by enhanced cleavage of membrane-bound proteins. One of the main proteases responsible for ectodomain shedding is disintegrin and metalloproteinase domain-containing protein 17 (ADAM17). Given its potential role in aggravating vascular dysfunction, we examined the role of ADAM17 in active proteinase-3 (PR3)-positive ANCA-associated vasculitis (AAV). ADAM17 concentration was significantly increased in plasma samples from patients with active PR3-AAV compared with samples from patients in remission or from other controls with renal nonvascular diseases. Comparably, plasma levels of the ADAM17 substrate syndecan-1 were significantly enhanced in active AAV. We also observed that plasma-derived ADAM17 retained its specific proteolytic activity and was partly located on extracellular microparticles. Transcript levels of ADAM17 were increased in blood samples of patients with active AAV, but those of ADAM10 or tissue inhibitor of metalloproteinases 3, which inhibits ADAMs, were not. We also performed a microRNA (miR) screen and identified miR-634 as significantly upregulated in blood samples from patients with active AAV. In vitro, miR-634 mimics induced a proinflammatory phenotype in monocyte-derived macrophages, with enhanced expression and release of ADAM17 and IL-6. These data suggest that ADAM17 has a prominent role in AAV and might account for the vascular complications associated with this disease.

Endothelial-derived thrombospondin-1 promotes macrophage recruitment and apoptotic cell clearance

Rapid apoptotic cell engulfment is crucial for prevention of inflammation and autoimmune diseases and is conducted by special immunocompetent cells like macrophages or immature dendritic cells. We recently demonstrated that endothelial cells (ECs) also participate in apoptotic cell clearance. However, in contrast to conventional phagocytes they respond with an inflammatory phenotype. To further confirm these pro‐inflammatory responses human ECs were exposed to apoptotic murine ECs and changes in thrombospondin‐1 (TSP‐1) expression and in activation of intracellular signalling cascades were determined by real‐time qPCR, immunoblotting and immunocytochemistry. Human primary macrophages or monocytic lymphoma cells (U937) were incubated with conditioned supernatant of human ECs exposed to apoptotic cells and changes in activation, migration and phagocytosis were monitored. Finally, plasma levels of TSP‐1 in patients with anti‐neutrophil cytoplasmic antibody(ANCA)‐associated vasculitis (AAV) were determined by ELISA. We provided evidence that apoptotic cells induce enhanced expression of TSP‐1 in human ECs and that this increase in TSP‐1 is mediated by the mitogen‐activated protein kinases (MAPK) ERK1 and 2 and their upstream regulators MEK and B‐Raf. We also showed that plasma TSP‐1 levels are increased in patients with AAV. Finally, we showed that conditioned supernatant of ECs exposed to apoptotic cells induces pro‐inflammatory responses in monocytes or U937 cells and demonstrated that increased TSP‐1 expression enhances migration and facilitates engulfment of apoptotic cells by monocyte‐derived macrophages or U937 cells. These findings suggest that under pathological conditions with high numbers of uncleared dying cells in the circulation endothelial‐derived elevated TSP‐1 level may serve as an attraction signal for phagocytes promoting enhanced recognition and clearance of apoptotic cells.

Knockdown of the Hypertension-Associated Gene NOSTRIN Alters Glomerular Barrier Function in Zebrafish (Danio rerio)

Hypertension is one of the major risk factors for chronic kidney disease. Using quantitative trait loci analysis, we identified the gene of the F-BAR protein NOSTRIN in the center of an overlapping region in rat and human quantitative trait loci that are associated with hypertension. Immunohistochemical analysis revealed a predominantly podocytic expression pattern of NOSTRIN in human and mouse glomeruli. Further, NOSTRIN colocalizes with cell–cell contact–associated proteins &bgr;-catenin and zonula occludens-1 and interacts with the slit-membrane–associated adaptor protein CD2AP. In zebrafish larvae, knockdown of nostrin alters the glomerular filtration barrier function, inducing proteinuria and leading to ultrastructural morphological changes on the endothelial and epithelial side and of the glomerular basement membrane of the glomerular capillary loop. We conclude that NOSTRIN expression is an important factor for the integrity of the glomerular filtration barrier. Disease-related alteration of NOSTRIN expression may not only affect the vascular endothelium and, therefore, contribute to endothelial cell dysfunction but might also contribute to the development of podocyte disease and proteinuria.

Knockdown of Glypican-1 and 5 isoforms causes proteinuria and glomerular injury in zebrafish (Danio rerio)

Components of the glycocalyx are being intensively studied for their involvement in a vast array of glomerular diseases. Among the most abundant proteoglycans in the glomerular cell glycocalyx are the heparan sulfate proteoglycans Glypican-1 and 5, expressed predominantly in glomerular endothelial and epithelial cells, respectively. We used a previously characterized zebrafish model to define the role of all different in zebrafish existing isoforms of Glypican-1 (a and b) and 5 (a,b and c) in vascular and renal pathology and tested the hypothesis that Glypican expression is important for the integrity of the glomerular barrier. Glypican morpholino knockdown in l-fabp:DBP-eGFP fish showed edematous phenotypes and a significant reduction of eye fluorescence for Glypican-1a, 5a und 5c, but not for Glypican1b and 5b isoforms. This indicates a significant loss of plasma proteins following knockdown of Glypican-1a, 5a and 5c in contrast to a conserved filtration barrier following knockdown of Glypican-1b and 5b isoforms. Knockdown of all different examined Glypican isoforms did not interfere with early nephron development as shown in the WT1b fish strain. Using electron microscopy, we could demonstrate that Glypican-1a knockdown leads to a predominantly endothelial cell injury with preservation of podocyte foot processes, while knockdown of Glypicans5a and 5c shows focal podocyte effacement with conserved endothelial structures. Ultrastructural analysis of glomeruli following knockdown of Glypicans-1b and 5b reveals normal glomerular structure. In this brief study we demonstrate in an in-vivo model that the Glypican proteoglycan family is critical in vascular and glomerular integrity. Our observations suggest a role for Glypican1a in endothelial cell and Glypican-5a and 5b in podocyte cell injury leading to subsequent loss of glomerular filtration barrier function and proteinuria. Correspondence to: Dr. med. K. Stahl,Nephrology Division, Department of Internal medicine, Hannover Medical School, Carl Neuberg Strasse 130625 Hannover, Germany, Tel: (0049) 5115326319; Fax: (0049) 511552366, E-mail: stahl.klaus@mh-hannover.de Received: January 04, 2017; Accepted: January 17, 2017; Published: January 19, 2017 Abbreviations: hpf: hours post fertilization Introduction Quantitative changes in heparan sulfate proteoglycans have been associated with a wide range of inflammatory and proteinuric nephropathies, including diabetic nephropathy, minimal change disease, membranous nephropathy, systemic lupus associated nephropathy and various rodent models of nephrotic syndrome [1,2]. Of the diverse Glypican proteoglycan family Glypicans-1, 3, 4 and 5 are found in the human kidney. [3-5]. Recently, Okamoto et. al. identified through a genome wide association study and replication analysis a certain variant of Glypican-5 as a new susceptibility gene for acquired nephrotic syndrome [6]. Glypican-1 is one of the most important cell surface associated glomerular heparan sulfate proteoglycans and is expressed in both glomerular epithelial as well as glomerular endothelial cells 1. However, not much is known until now about a possible association of Glypican-1 with kidney disease. While in humans only six different Gypican proteins exist [7], in zebrafish ten different Glypican proteins have been isolated [8]. In contrast to humans, in zebrafish two different isoforms of Glypican-1, named Glypican-1a and 1b, and three different isoforms of Glypican 5, named Glypican-5a, 5b and 5c, have been identified 8. In this present study we examined the role of the Glypican-1 (a and b) and Glypican-5 (a,b and c) genes in glomerular and vascular physiology employing a zebrafish model. We present evidence for an important role of this protein in the development of proteinuria as well as vascular permeability and describe for the first time a model of glomerular pathology of Glypican-1 and Glypican-5 in an in-vivo setting. Materials and methods All methods applied in this study have been extensively described by our laboratory previously 9, and will therefore be described in a short fashion. Zebrafish stocks and embryos Zebrafish, Wildtype AB and the Transgenic zebrafish lines Tg(lfabp:DBP-eGFP) 10, Tg(flk:mcherry/l-fabp:DBP-eGFP) and Wt1bGFP 11, were grown and mated at 28.5°C. Embryos were kept and handled in standard E3 solution buffered with 2 mM HEPES as previously described previous 12,13. All zebrafish studies were conducted in accordance with the National Institutes of Health Guide Stahl K (2017) Knockdown of Glypican-1 and 5 isoforms causes proteinuria and glomerular injury in zebrafish (Danio rerio) Nephrol Renal Dis, 2017 doi: 10.15761/NRD.1000117 Volume 2(1): 2-5 for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee (IACUC) under approval #14-06. Zebrafish morpholino injection As decribed before by our group, Glypican-1a and 1b, Glypican 5a, 5b and 5c as well as control morpholinos were injected into one to four-cell stage fertilized embryos at a concentration of 100μM. Morpholino sequences were ordered from GeneTools (Philomath, OR) as follows: control sequence 5’ CCTCTTACCTCAGTTACAATTTATA-3’, Glypican-1a sequence 5’ AAAAAGAGCTGTTGACTCACTGTCA-3’, Glypican-1b sequence 5’ CAGCAGGACCGATTCACCTACCGGA-3’, Glypican-5a sequence 5’ TAACCACACACTCATCCTCTCACCT-3’, Glypican-5b sequence 5’ AATGTTTTTGGACCTACCTGGTTGA-3’ and Glypican-5c sequence 5’ACATGACGGCATTTCAGTGGAGAAA -3’. The Glypican1a/1b/5a/5b morpholino constructs act as a splice donor, initiating wrong pre-mRNA splicing in the region between exon2-intron2/ exon1-intron1/exon1-intron1/exon7-intron7, respectively. The Glypican-5c morpholino construct works as a translation blocker by binding close to the translational start site of the′complementary mRNA in the 5 -untranslated region. Fluorescence proteinuria measurements –fabp eye assay 72 hours post fertilization (hpf) dechorionated Tg(l fabp:DBPeGFP) embryos were anesthetized with a 1:20 to 1:100 dilution of 4 mg/ml Tricaine, placed in 200 μl E3 in single wells of 96 well plates and allowed to recover. Sequential images of live fish were then generated 96 and 120hpf using the Axiovert 200 microscope connected to an AxioCam charge-coupled device camera, and images were taken using the Axio Vision release 4.5 SP1 software package. The maximum fluorescence intensities of grayscale images of the pupil of the fish were measured using NIH’s ImageJ application and reported in relative units of brightness as previously described by our group. Assay for glomerular fusion – WT1b fish Normal development and the fusion of the zebrafish pronephros was documented in the WT1b:eGFP fish line 72hpf for all Glypican isoforms at a morpholino concentration of 100 μM. Histology and transmission electron microscopy (TEM) Morphant larval zebrafish were sampled at 120 hpf and fixed, washed and embedded with epon according to manufacturer’s protocol (Hard Plus Resin 812, Electronmicroscopy Sciences, Hatfield, PA). Ultrathin sections of 70-90 nm were imaged using a JEOL-1230 or a Morgagni (FEI, Eindhoven) transmission electron microscope, operated at 80 kV.

PRKC-isoform mRNA expression in human kidney transplant protocol biopsies: is there a high-glucose-induced regulation in the diabetic state?

Dear Sirs, Protein kinase C (PRKC) is a family of at least twelve serine–threonine kinases and a key signaling pathway in diabetic vascular complications [1]. Our group recently demonstrated that deletion of distinct PRKC isoforms in vivo prevents from diabetes-induced kidney damage, probably depending on the individual cell type or tissue, which subsequently interferes with experimental diabetic nephropathy through independent molecular mechanisms [1]. Data on renal PRKC transcript expression profiles in the early development of human diabetic kidney damage are, however, still missing. Therefore, the aim of this pilot study was to determine the transcript expression levels of renal PRKC isoforms a, b1, c, d, e, g, h, i by real-time quantitative PCR (qPCR) in three consecutive archival control kidney biopsies of diabetic transplant recipients and to compare to case-matched, non-diabetic controls. We retrospectively analyzed data from diabetic patients (n = 11) and case-matched, non-diabetic controls (n = 11) enrolled in the protocol biopsy program of the transplant center of the Hannover Medical School which is part of the routine medical care following kidney transplantation [2]. From these two study groups, RNA-later-embedded frozen biopsy samples collected 6 weeks (K1), 3 months (K2), and 6 months (K3) after kidney transplantation were subjected to PRKC-isoform-specific qPCR. The program had been approved by the local ethical committee and is conducted in accordance with the Declaration of Helsinki. The key findings of this pilot study were that although (1) the main PRKC isoforms (a, b1, e, f) are expressed early in human kidney transplants, (2) PRKC-isoform mRNA expression does not dynamically increase over time in a diabetic milieu in the first 6 months after kidney transplantation (Fig. 1). In contrast, we observed that (3) mRNA expression of the PRKC-f isoform was significantly decreased at time point 3 (K 3; 6 months after kidney transplantation) in the diabetic group compared to non-diabetic controls. Interestingly, previous observations many years ago showed that, in addition to PRKC activation through increased serine/threonine phosphorylation under hyperglycemic condition, high glucose also induces protein expression of PRKC-isoforms a, b, and e in mesangial cells after 48 h, but not after 12 h [3]. Toyoda et al. [4] suggested for the first time that elevated expression of PRKC–MAPK pathway mRNAs correlates with glomerular lesions in patients with overt diabetic nephropathy. Recently, Langham et al. [5] postulated that increased PRKC-b transcription measured by qPCR occurs in advanced human diabetic nephropathy by analyzing human kidney biopsies with longterm DM. In contrast to the latter study, our results did not show any significant up-regulation of any PRKC-isoform transcript expression using archival biopsy tissue within the first 6 months following human kidney transplantation in diabetic compared to non-diabetic recipients. We did not find a significant correlation between PRKC-isoform mRNA expression levels and HbA1c at the three distinct time points of biopsy. We also did not observe any relationship between PRKC-isoform mRNA expression and other laboratory or Communicated by Renato Lauro.