Minako Koura

Mosaic structures of neurotoxins produced from Clostridium botulinum types C and D organisms

We isolated the gene encoding a botulinum neurotoxin (BoNT) of 1285 amino acids with a molecular weight of 147,364 from the toxigenic bacteriophage d-sA of Clostridium botulinum type D strain South African (Dsa). The BoNT of Dsa (BoNT/Dsa) is composed of three regions on the basis of the homology to BoNT types C1 (BoNT/C1) and D (BoNT/D). The N-terminal (Met-1 to Val-522) and the C-terminal regions (Trp-945 to Glu-1285) have high identity to corresponding regions of BoNT/D (96% identity) and BoNT/C1 (74% identity), respectively. The core region (Pro-523 to Lys-944) is common to three toxins (83% to 92% identity). These results suggest that neurotoxins produced from Clostridium botulinum types C and D are composed in a mosaic-like fashion.

Sequence Analysis of the actA Gene of Listeria monocytogenes Isolated from Human

The region encoding proline‐rich units of actA genes was amplified from 24 strains of Listeria monocytogenes using polymerase chain reaction (PCR). PCR products of 13 strains showed the expected size of 623 bp, whereas those of 11 strains showed a short size of 518 bp. The shortening of these PCR products resulted from the deletion of one proline‐rich unit. These results indicate that ActA proteins are divided into at least two different types which are unrelated to bacterial serotypes.

Involvement of SIK3 in Glucose and Lipid Homeostasis in Mice

Salt-inducible kinase 3 (SIK3), an AMP-activated protein kinase-related kinase, is induced in the murine liver after the consumption of a diet rich in fat, sucrose, and cholesterol. To examine whether SIK3 can modulate glucose and lipid metabolism in the liver, we analyzed phenotypes of SIK3-deficent mice. Sik3 −/− mice have a malnourished the phenotype (i.e., lipodystrophy, hypolipidemia, hypoglycemia, and hyper-insulin sensitivity) accompanied by cholestasis and cholelithiasis. The hypoglycemic and hyper-insulin-sensitive phenotypes may be due to reduced energy storage, which is represented by the low expression levels of mRNA for components of the fatty acid synthesis pathways in the liver. The biliary disorders in Sik3 −/− mice are associated with the dysregulation of gene expression programs that respond to nutritional stresses and are probably regulated by nuclear receptors. Retinoic acid plays a role in cholesterol and bile acid homeostasis, wheras ALDH1a which produces retinoic acid, is expressed at low levels in Sik3 −/− mice. Lipid metabolism disorders in Sik3 −/− mice are ameliorated by the treatment with 9-cis-retinoic acid. In conclusion, SIK3 is a novel energy regulator that modulates cholesterol and bile acid metabolism by coupling with retinoid metabolism, and may alter the size of energy storage in mice.

UV-B Irradiation Increases Susceptibility of Mice to Malarial Infection

ABSTRACT We here examined whether exposure of mice to UV-B affected their susceptibility to the murine malaria parasite Plasmodium chabaudi. When BALB/c mice with depilated skin were irradiated with UV-B and subsequently infected with the parasite, 80 to 100% of the UV-B-irradiated mice died within 12 days of infection with a sublethal dose. In addition, UV-B irradiation of C57BL/10 (B-10) mice, which are otherwise naturally resistant to the parasites, rendered them susceptible, and 100% of irradiated B-10 mice died within 11 days postinfection. The level of plasma gamma interferon (IFN-γ) in unirradiated B-10 mice at 5 days after infection increased to 566 pg/ml, whereas the UV-B exposure of mice impaired the production of IFN-γ, which showed a maximum level of 65 pg/ml in response to the parasite infection. The maximum level of plasma interleukin-10 in UV-B-irradiated mice in response to the parasite infection was ∼1,100 pg/ml, which was approximately fourfold higher than the maximum level in unirradiated control mice. When UV-B-irradiated B-10 mice were administered murine recombinant IFN-γ after infection, the mice regained parasite resistance. These results demonstrated that the UV-B exposure of mice enhances the susceptibility to the malaria parasites and suggested that the enhanced susceptibility following UV-B exposure was mediated by impairment of IFN-γ production in response to the parasite infection.

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes

FAM83H is essential for the formation of dental enamel because a mutation in the FAM83H gene causes amelogenesis imperfecta (AI). We previously reported that the overexpression of FAM83H often occurs and disorganizes the keratin cytoskeleton in colorectal cancer cells. We herein show that FAM83H regulates the organization of the keratin cytoskeleton and maintains the formation of desmosomes in ameloblastoma cells. FAM83H is expressed and localized on keratin filaments in human ameloblastoma cell lines and in mouse ameloblasts and epidermal germinative cells in vivo. FAM83H shows preferential localization to keratin filaments around the nucleus that often extend to cell-cell junctions. Alterations in the function of FAM83H by its overexpression, knockdown, or an AI-causing truncated mutant prevent the proper organization of the keratin cytoskeleton in ameloblastoma cells. Furthermore, the AI-causing mutant prevents desmosomal proteins from being localized to cell-cell junctions. The effects of the AI-causing mutant depend on its binding to and possible inhibition of casein kinase I (CK-1). The suppression of CK-1 by its inhibitor, D4476, disorganizes the keratin cytoskeleton. Our results suggest that AI caused by the FAM83H mutation is mediated by the disorganization of the keratin cytoskeleton and subsequent disruption of desmosomes in ameloblasts.

Infection of Immunodeficient Mice with a Mouse-Adapted Substrain of the Gray Strain of Babesia microti

A mouse-adapted substrain was recovered from a severe combined immunodeficient (SCID) mouse inoculated with the Gray strain of Babesia microti. In contrast to the original Gray strain, infection with this substrain (Gray/mo strain) resulted in a high level of parasitemia for a long period in SCID and nude mice, whereas immunocompetent BALB/c mice controlled the infection. The infection profile with the Gray/mo strain was closer to that of human babesiosis than that with the original Gray strain, suggesting usefulness of this mouse model for immunological studies of babesial infection. No antibody activity was revealed in sera of the infected SCID and nude mice. Although strong antibody activity was shown in the sera of the recovered BALB/c mice, no protective activity was demonstrated by the immune serum. Adaptive transfer of thymocytes from the normal BALB/c mouse resulted in SCID and nude mice being able to control the infection, indicating that cell-mediated immunity played a major role in control of infection with B. microti. However, because the reconstituted mice also produced significant antibody titer, antibody remains a possibility for a supportive role in control of the infection.

An electron microscopic study of glomerular lesions in hereditary nephrotic mice (ICGN strain)

Glomerular lesions in hereditary nephrotic mice (ICGN strain) were investigated by electron microscopy. The glomeruli of unaffected animals, which appeared normal by light microscopy, had developed an ultrastructural change in the glomerular capillary basement membrane (GCBM). There was a partial thickening of the GCBM with bilaminar splitting of the lamina densa and an electron-dense fibrillar material exhibiting cross-striations. In affected animals, light microscopy revealed a marked thickening of GCBM and an increase of mesangial matrix without cellular proliferaton. By electron microscopy, multilaminar splitting of the lamina densa in the thickened GCBMs and fusion of the epithelial foot processes were observed. In some severely affected animals, immune complex deposition was found in GCBM, but little if any was observed in other animals. In the end, the glomeruli were globally sclerosed. Our findings suggest that initial structural abnormalities in GCBM may play an important role in the onset and development of the disease, though subsequent events such as immune complex deposition would modify the disease.

Adult onset cardiac dilatation in a transgenic mouse line with Galβ1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galβ1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Zygosity Determination in Hairless Mice by PCR Based on Hr hr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hrhr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hrhr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hrhr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hrhr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hrhr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

A New Mouse Allele of Glutamate Receptor Delta 2 with Cerebellar Atrophy and Progressive Ataxia

Spinocerebellar degenerations (SCDs) are a large class of sporadic or hereditary neurodegenerative disorders characterized by progressive motion defects and degenerative changes in the cerebellum and other parts of the CNS. Here we report the identification and establishment from a C57BL/6J mouse colony of a novel mouse line developing spontaneous progressive ataxia, which we refer to as ts3. Frequency of the phenotypic expression was consistent with an autosomal recessive Mendelian trait of inheritance, suggesting that a single gene mutation is responsible for the ataxic phenotype of this line. The onset of ataxia was observed at about three weeks of age, which slowly progressed until the hind limbs became entirely paralyzed in many cases. Micro-MRI study revealed significant cerebellar atrophy in all the ataxic mice, although individual variations were observed. Detailed histological analyses demonstrated significant atrophy of the anterior folia with reduced granule cells (GC) and abnormal morphology of cerebellar Purkinje cells (PC). Study by ultra-high voltage electron microscopy (UHVEM) further indicated aberrant morphology of PC dendrites and their spines, suggesting both morphological and functional abnormalities of the PC in the mutants. Immunohistochemical studies also revealed defects in parallel fiber (PF)–PC synapse formation and abnormal distal extension of climbing fibers (CF). Based on the phenotypic similarities of the ts3 mutant with other known ataxic mutants, we performed immunohistological analyses and found that expression levels of two genes and their products, glutamate receptor delta2 (grid2) and its ligand, cerebellin1 (Cbln1), are significantly reduced or undetectable. Finally, we sequenced the candidate genes and detected a large deletion in the coding region of the grid2 gene. Our present study suggests that ts3 is a new allele of the grid2 gene, which causes similar but different phenotypes as compared to other grid2 mutants.