Mohamed Chakroun

Monitoring of HIV-1 resistance in Tunisia (North Africa) with a dried plasma spot strategy.

To the Editor: The HIV-1 epidemic is particularly severe in the resource-limited countries, where more than 30 million people are living with HIV infection. The expansion of access to antiretroviral drugs has made it necessary to develop appropriate tools for the therapeutic follow-up of patients in these regions. Epidemiologic surveillance of the spread and transmission of HIV resistant to antiretroviral drugs is also a major issue for the future use of these drugs in the resource-limited countries. Resistance genotyping has proved useful for such monitoring in the more developed countries. This method requires a sequencer, however, and its routine use outside a few reference centers is therefore difficult in resourcelimited countries. It also poses logistic problems in terms of the transport and storage of plasma samples. Many studies have demonstrated the utility of dried sample spot technology as an alternative method for serologic and molecular analyses of HIV infection. We recently demonstrated the feasibility of using a dried plasma spot/dried serum spot (DPS/DSS) method for resistance genotyping, which could be a useful alternative in clinical and epidemiologic settings. In this study, we tested a sequencing-based strategy for monitoring from a distance, in which plasma samples were collected far from the center with the sequencer and the expertise to interpret the results. Blood samples were taken from patients positive for HIV-1 in Tunisia. Plasma samples were deposited on filter paper, allowed to dry, and sent by post to our laboratory in France for analysis of resistance to antiretroviral drugs. We obtained 33 plasma samples from 24 HIV-1–infected Tunisian patients with a plasma viral load (VL) ranging from 1300 copies/mL (3.1 log) to more than 750,000 copies/mL (5.9 log) (Table 1). Samples were collected from patients who had never received highly active antiretroviral treatment (HAART) (n = 13) and from treated patients (n = 5). Serial plasma samples were collected during treatment (patient [P] 5, P15, P18, and P22) or before and during treatment (P6 and P8). VL was measured in native samples (stored at 80(C) with an Amplicor HIV-1 Monitor (version 1.5; Roche Diagnostics, Meylan, France) before spotting. A total of 20 mL of each plasma sample was spotted onto the centers of 6 circles drawn on S&S903 filter paper (Schleicher & Schuell, BioScience/Whatman, GmbH, Dassel, Germany). Filters were left to dry for 1 hour at room temperature, placed individually in small plastic bags with a sachet of desiccant, stored, and mailed to France at room temperature. A period of 9 days elapsed between sample collection and the arrival of the sample at the laboratory in Rouen. On arrival, the DPS samples were transferred to a 80(C freezer, in which they were stored until testing. RNA was extracted from a DPS, as previously described. In the absence of amplification, the extraction was repeated with another spot but with a supplementary 10-fold concentration step, using a Microcon YM-50 device (Millipore, Saint-Quentin en Yvelines, France); briefly, 100 mL of RNA eluate was deposited into the Microcon YM-50 device, centrifuged for 2 minutes at 14,000g to obtain a concentrate of 10 mL, and recovered by centrifugation for 3 minutes at 1000g turning the Microcon YM-50 device, as recommended by the manufacturer. A nested reverse transcriptase (RT) polymerase chain reaction (PCR) assay was used to amplify the protease and RT regions of the pol gene, as previously described, yielding fragments of 507 and 798 base pairs (bp), respectively. A 655bp fragment of the gp41 region encompassing the enfuvirtide (T20) target was also amplified, as follows: RNA (10 mL) was amplified in a 50-mL reaction mixture containing 2 mM of MgSO4, 20 pmol of each outer primer (1S TGGAG GAGGAGATATGAGG and AS1 GTG AGTATCCCTGCCTAACTCTAT), and 1 mL of RT/platinum Taq. Amplification reactions were carried out in a PerkinElmer (Courtaboeuf, France) 2400 thermocycler as follows: 1 cycle at 50(C for 30 minutes and 94(C for 2 minutes; followed by 35 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 68(C for 60 seconds; and a final extension step at 72(C for 7 minutes. A nested PCR assay was performed, as previously described for the RT and protease fragments, and using 20 pmol of gp41 inner primers (T20S1 GAG GGACAATTGGAGAAGTGAATT and 2AS CTACCAAGCCTCCTACTATC) with amplification conditions as follows: heating at 95(C for 15 minutes; 30 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 72(C for 30 seconds; and a final extension step at 72(C for 7 minutes Amplification products were visualized by electrophoresis in a 1% agarose gel, with ethidium bromide staining. Resistance genotyping and genetic subtyping were carried out by sequencing and phylogenetic analysis, as previously described. The resistance mutations were interpreted with the Agence Nationale de Recherches sur le Sida et les Hépatites Virales (ANRS) algorithm (July 2006 version; available at: http://www. hivfrenchresistance.org/). The results obtained are presented in Table 1. The RT-PCR techniques used to amplify the protease, RT, and gp41 regions were validated on native reference plasma samples as controls. The protease region of the 33 native plasma samples could be amplified with the protocol used, whatever the VL. The RT and gp41 regions of 3 patients (P31 for RT and P21 and P27 for gp41) could not be amplified from the native reference plasma sample, and from the corresponding DPS sample. Difficulties were encountered in amplification of the gp41 region of samples from P8: no amplification was obtained with 2 of the 3 samples available. These difficulties with the amplification of gp41 in 3 patients (P8, P21, and P27) suggest that the PCR was less robust for this fragment. The protease and RT regions were successfully amplified from all DPS samples with a VL

Profile of drug resistance mutations among HIV-1-infected Tunisian subjects failing antiretroviral therapy

5 log (21 of 21 samples), and the gp41 region was successfully amplified in 19 of 20 cases (1 native plasma sample was not amplified with our protocol; see Table 1). The

Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

Three years after the introduction of antiretroviral therapy (ART) in Tunisia (North Africa), we aimed to determine the prevalence of drug resistance mutations in Tunisian HIV-1-infected patients failing ART. Plasma samples of 80 patients were tested for genotypic resistance using two distinct line probe assays, LiPA HIV-1 reverse transcriptase RT and LiPA HIV-1 protease assay. Of the 80 patients, 82.5% showed resistance to at least one antiretroviral molecule. In the RT gene, resistance to nucleoside RT inhibitors (NRTIs) and non-nucleoside RT inhibitors (NNRTIs) were recognized in 66.25 and 37.5%, respectively, with M184V, T215Y and K103N being the codons most frequently involved. Resistance to protease inhibitors (PIs) was found in 46.25% of cases. Despite the presence of different mutations, the viral variants were still susceptible to other RTIs and PIs that are currently not available in Tunisia. Thus, alternative therapeutic options exist but are not yet accessible.

Serologic evidence of exposure to Rift Valley fever virus detected in Tunisia

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv) is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181) and a high risk group of humans, mainly slaughter workers (n = 38), were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia.

Epidemiological aspects of Brucellosis in the center of Tunisia: which features in 2016

Rift Valley fever virus (RVFv) is capable of causing dramatic outbreaks amongst economically important animal species and is capable of causing severe symptoms and mortality in humans. RVFv is known to circulate widely throughout East Africa; serologic evidence of exposure has also been found in some northern African countries, including Mauritania. This study aimed to ascertain whether RVFv is circulating in regions beyond its known geographic range. Samples from febrile patients (n = 181) and nonfebrile healthy agricultural and slaughterhouse workers (n = 38) were collected during the summer of 2014 and surveyed for exposure to RVFv by both serologic tests and PCR. Of the 219 samples tested, 7.8% of nonfebrile participants showed immunoglobulin G reactivity to RVFv nucleoprotein and 8.3% of febrile patients showed immunoglobulin M reactivity, with the latter samples indicating recent exposure to the virus. Our results suggest an active circulation of RVFv and evidence of human exposure in the population of Tunisia.

Causes de décès des patients infectés par le VIH dans le Centre Tunisien

Introduction : brucellosis is a highly contagious zoonosis with high morbidity in human. The objective of this study is to describe epidemiological and clinical aspects and therapeutic outcomes of brucellosis in an endemic region. Methods : retrospective study performed between 1996 and 2016 in the center of Tunisia in which adult patients with active brucellosis referred to the department of Infectious Diseases were chosen. Results : thirty one cases were included, the mean age was 41,8 years (5 to 83 years). A female predominance was observed (F: M sex ratio, 1,2). Of them, 74,2% were diagnosed as acute (n = 23) and 25,8% as sub-acute brucellosis (n = 8). Risk factors were consumption of unpasteurized milk and dairy products (n=29, 93,5%) and risky profession (n = 9, 29%). Among them, we noted eight farmers and one veterinary. Family history was positive for brucellosis in five cases (16,1%). The most common complaint was fever in 26 cases (84%). Spondylodiscitis was the most common form of presentation of sub-acute brucellosis (n = 2, 25%). The average time limit of consultation was 37,6 days (2-240 days) for acute brucellosis and 55,5 days (21-120 days) for sub-acute brucellosis. In all cases agglutination tests were positive. At enrolment, Wright test was positive in 30 cases (96,7%) with an average of 1833,6UI/ml (60-17220 UI/ml). Elevated liver enzymes was observed in 6 cases (19,3%) and leucopenia in 4 cases (13%). The C-reactive protein and sedimentation rate were evaluated with an average of 21,7 mg/l and 50 mm, respectively. Doxycyline and rifampicin combination during 6 weeks was the most preferred therapy protocol (61,3%). Relapse was detected in 2 cases. Conclusion : despite the efforts to reduce the incidence of brucellosis, it is still an important health problem in Tunisia. Early detection and prompt treatment can provide rapid recovery and prevent complication or sequels.

Epidemiology of infective endocarditis in Tunisia: a 10-year multicenter retrospective study

La trithérapie antirétrovirale a contribué à une baisse considérable de la mortalité liée au VIH. Les causes de décès sont dominées par les infections opportunistes dans les pays en voie de développement et par les maladies cardiovasculaires et les cancers dans les pays développés. L’objectif était de déterminer les causes et les facteurs de risque de décès des patients infectés par le VIH dans le Centre Tunisien. Une étude transversale auprès des patients infectés par le VIH âgés de plus de 15 ans suivis à Sousse et à Monastir entre 2000 et 2014. Le décès était considéré lié au VIH si la cause était un évènement classant SIDA ou s’il était la conséquence d’une infection opportuniste d’étiologie indéterminée avec des CD4 < 50/mm3, non lié au VIH si la cause n’était pas un évènement classant SIDA, et de cause inconnue si aucune information n’était disponible. Deux cents treize patients, 130 hommes (61%) et 83 femmes (39%), d’âge moyen 40±11 ans ont été inclus. Cinquante quatre patients sont décédés, avec une mortalité de 5,4/100 patients-années. La mortalité annuelle a baissé de 5,8% en 2000-2003 à 2,3% en 2012-2014. La survie était de 72% à 5 ans et de 67% à 10 ans. Les décès étaient liés au VIH dans 70,4% des cas. Les causes de décès les plus fréquentes étaient la pneumocystose pulmonaire et la cryptococcose neuroméningée dans 6 cas (11%) chacune. Les facteurs de risque de décès étaient les antécédents d’infections opportunistes, la durée de la trithérapie antirétrovirale < 12 mois et le tabagisme. Le renforcement du dépistage, l’initiation précoce de la trithérapie antirétrovirale, et la lutte contre le tabagisme sont nécessaires afin de réduire la mortalité chez les patients infectés par le VIH en Tunisie.