Mongi Benjeddou

Detection of Acute Bee Paralysis Virus and Black Queen Cell Virus from Honeybees by Reverse Transcriptase PCR

ABSTRACT A reverse transcriptase PCR (RT-PCR) assay was developed for the detection of acute bee paralysis virus (ABPV) and black queen cell virus (BQCV), two honeybee viruses. Complete genome sequences were used to design unique PCR primers within a 1-kb region from the 3′ end of both genomes to amplify a fragment of 900 bp from ABPV and 700 bp from BQCV. The combined guanidinium thiocyanate and silica membrane method was used to extract total RNA from samples of healthy and laboratory-infected bee pupae. In a blind test, RT-PCR successfully identified the samples containing ABPV and BQCV. Sensitivities were approximately 1,600 genome equivalents of purified ABPV and 130 genome equivalents of BQCV.

Characterization of the highly discriminatory loci DYS449, DYS481, DYS518, DYS612, DYS626, DYS644 and DYS710

During the study of genetic diversity at non-core Y-STRs in South African population groups, we identified loci with high discrimination capacity. In this study we present a detailed account of the allele diversity, allele sequence data, gene diversity, allele frequency spectrum and informativeness for assignment in the European English, Asian Indian and Xhosa population groups at loci DYS449, DYS481, DYS518, DYS612, DYS626, DYS644 and DYS710. The suitability of these loci for forensic, genealogical and evolutionary studies is discussed, and nomenclature for loci DYS518, DYS612, DYS626 and DYS644 is suggested.

Allele frequencies of six non-CODIS miniSTR loci (D1S1627, D3S4529, D5S2500, D6S1017, D8S1115 and D9S2157) in three South African populations

Abstract The allele frequency of six non-CODIS miniSTR loci: D1S1627, D3S4529, D5S2500, D6S1017, D8S1115 and D9S2157 were investigated in three South African populations (Afrikaner, Asian Indian and Mixed Ancestry). Deviation from Hardy–Weinberg equilibrium was observed in the Mixed Ancestry population for the locus D9S2157. All loci showed a moderate degree of polymorphism with heterozygosity values >0.6 for all populations. The combined power of discrimination was: 0.999997723, 0.999997163 and 0.99999961 for Afrikaner, Asian Indian and Mixed Ancestry populations, respectively. The respective values for the combined power of exclusion in these populations were: 0.99, 0.99 and 0.98.

Analysis of seventeen Y-chromosome STR loci in the Cape Muslim population of South Africa

Two Y-STR genotyping systems were evaluated for usefulness in forensic casework in the Cape Muslim population of South Africa. Samples were collected from 105 males, and genotyped for 17 loci amplified in two multiplexes. Allele and haplotype frequencies were determined for nine Y-STR loci used to define the minimal haplotype (DYS19, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, and the duplicated locus DYS385) amplified in one multiplex, as well as for eight widely used loci amplified in a second multiplex and consisting of DYS449, DYS481, DYS518, DYS557, DYS570, DYS607, DYS612 and DYS614. When analysing the samples for all the loci, 104 unique haplotypes were obtained, and the discrimination capacity was 0.990. When considering only the nine Y-STRs included in the minimal haplotype, 91 unique haplotypes were obtained, and the discrimination capacity was 0.866. In the case of the remaining eight Y-STR loci, values of 97 and 0.924 were obtained, respectively.

Nine-locus Y-STR profiles of Afrikaner Caucasian and mixed ancestry populations from Cape Town, South Africa.

Samples were collected from 108 Afrikaner males and 114 males of mixed ancestry. The term mixed ancestry is being used to denote a complex community which was established with contributions from Asians, Caucasians and Indigenous populations and constitutes a significant proportion of the Cape Town metropolitan population. Allele and haplotype frequencies were determined for nine Y-STR loci (DYS19, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393 and the duplicated locus DYS385). Unique haplotypes were obtained for 64 Afrikaner males and 90 males of mixed ancestry. Both population groups shared the same most common haplotype.

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa

Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885), P341L (rs2282143), V519F (rs78899680), and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357), C88R (rs55918055), S189L (rs34104736), G220V (rs36103319), P283L (rs4646277), R287G (rs4646278), G401S (rs34130495), M440I (rs35956182), or G465R (rs34059508). In addition, no variant alleles were observed for A306T (COSM164365), A413V (rs144322387), M420V (rs142448543), I421F (rs139512541), C436F (rs139512541), V501E (rs143175763), or I542V (rs137928512) in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

The value of Non-CODIS miniSTR genotyping systems in forensic casework in South Africa

Genetic identity testing is achieved by examining polymorphic regions of DNA. Currently, STR markers are the most commonly used loci for human identification from which several commercial genotyping systems have been developed based on the 13 core CODIS loci. However, identification of degraded or compromised DNA proved to be difficult. Recently, research into genetic typing systems has focused on making use of multiplex polymerase chain reaction (PCR) systems that have a reduced size of the PCR products, to improve the molecular analysis of degraded DNA samples in particular. Non-CODIS (NC) loci were therefore developed to aid the profiling of degraded or compromised DNA samples. This paper reviewed the latest developments and improvements on the non-commercial NC miniSTR genotyping systems. The development and validation of these systems are of great interest to South Africa, to reduce the cost of forensic casework.

Development of molecular tools for honeybee virus research: the South African contribution

Increasing knowledge of the association of honeybee viruses with other honeybee parasites, primarily the ectoparasitic mite Varroa destructor, and their implication in the mass mortality of honeybee colonies, has resulted in increasing awareness and interest in honeybee viruses. In addition the identification, monitoring and prevention of spread of bee viruses is of considerable importance, particularly when considering the lack of information on the natural incidence of virus infections in honeybee populations worldwide. A total of eighteen honeybee viruses have been identified and physically characterized. Most of them have physical features resembling picornaviruses, and are referred to as picorna-like viruses. The complete genome sequences of four picorna-like honeybee viruses, namely Acute Bee Paralysis Virus (ABPV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV) and Deformed Wing Virus (DWV) have been determined. The availability of this sequence data has lead to great advances in the studies on honey bee viruses. In particular, the development of a reverse genetics system for BQCV, will open new opportunities for studies directed at understanding the molecular biology, persistence, pathogenesis, and interaction of these bee viruses with other parasites. Since the BQCV genome can be manipulated, the potential of this virus as a vector can also be explored by insertion of sequences to express foreign proteins. This review examines the latest developments in bee virus research. This review focuses on the contribution of the Honeybee Virus Research Group (HBVRG), from the University of the Western Cape of South Africa, in the development of molecular tools for the study of molecular biology and pathology of these viruses. Key words : Honeybee, virus, Varroa destructor, picorna-like, reverse genetics, RT-PCR, infectious clone, infectious RNA. African Journal of Biotechnology Vol. 2 (12), pp. 698-703, December 2003

Effect of the African-specific promoter polymorphisms on the SLC22A2 gene expression levels

Abstract Background: Single nucleotide polymorphisms in promoter regions have been shown to alter the transcription of genes. Thus, SNPs in SLC22A2 can result in inter-individual variable response to medication. Methods: The objective of the study was to investigate the effect of the African-specific promoter polymorphisms on the SLC22A2 gene expression levels in vitro. These included rs572296424 and rs150063153, which have been previously identified in the Xhosa population of South Africa. The promoter region (300 bp) for the two haplotypes was cloned into the pGLOW promoterless GFP reporter vector. The GFP expression levels of each haplotype was determined in the HEK293 cells using a GlowMax Multi-Detection E7031 luminometer in the form of light emission. Results: The relative promoter activity suggests that no significant variation exists between the expression levels of the WT and -95 haplotypes and the -95 and -156 haplotypes (p=0.498). However, the relative promoter activity of the WT haplotype in comparison to the -156 haplotype displayed a significant difference in expression level (p=0.016). Conclusions: The data presented here show that the African-specific promoter polymorphisms can cause a decrease in the SLC22A2 gene expression levels in vitro, which in turn, may influence the pharmacokinetic profiles of cationic drugs.

SLC22A2 - mapping genomic variations within South African indigenous and admixed populations.

Abstract Background: The SLC22A2 gene is a polyspecific transporter that mediates the electrogenic transport of small organic cations with different molecular structures. Furthermore, single-nucleotide polymorphisms (SNPs) of SLC22A2 are clinically significant because they can alter the transport of substrate drugs and may, thus, influence the efficacy and toxicity thereof. Additionally, further studies have reported that SLC22A2 is responsible for 80% of the total metformin clearance. Therefore, loss-of-function variants of SLC22A2 could affect the pharmacokinetic and pharmacodynamic characteristics of metformin. Although it is widely accepted that African populations harbor a greater amount of genomic diversity compared to other populations, limited information is available regarding genetic polymorphisms in SLC genes among African populations, specifically those related to impaired functional activity of hOCT2. Therefore, the aim of this study was to map known impaired function variants in the SLC22A2 gene. Methods: Development of multiplex SNaPshot™ genotyping assay for 20 previously reported SLC22A2 nonsynonymous SNPs and the assessment of baseline allele frequencies of these variants in 140 Cape Admixed, 148 Xhosa and 152 Zulu individuals residing in Cape Town, South Africa. Results: We identified three nonsynonymous SNPs, namely, A270S, R400C and K432Q in the population studied at minor allele frequencies of 6.1%, 3.4% and 0.7%, respectively. The most frequently observed haplotypes across all three populations were CATAATGCGTACGCGCGACG (~85%), CATAATGATTACGCGCGACG (~7%) and CATAATGAGTACGCGCGACG (~4.5%). Conclusions: In addition to SNPs, the haplotypes identified in this study can in future also aid in identifying associations between causative genetic variants and drug response. This study contributes in filling the gap that exists with regards to genetic information about important variations in organic cation transporter genes for the indigenous populations of South Africa.