N. Mahfoudhi

Transmission of Grapevine Leafroll Viruses by Planococcus ficus (Hemiptera: Pseudococcidae) and Ceroplastes rusci (Hemiptera: Coccidae)

Grapevine leafroll associated virus-3 (GLRaV-3) and Grapevine leafroll associated virus-5 (GLRaV-5), two members of the genus Ampelovirus associated with grapevine leafroll disease, were transmitted by the mealybug Planococcus ficus and the soft scale insect Ceroplastes rusci from infected to healthy vines under experimental conditions. The efficiencies of transmission of GLRaV-3 and GLRaV-5 by P. ficus were 23.3 and 8.3%, respectively, and by C. rusci were 3.3 and 1.7%, respectively. Juvenile instars of P. ficus were more efficient in transmission of the viruses than adult females. This is the first report of the ability of C. rusci to transmit these viruses to grapevines.

OCCURRENCE AND WIDESPREAD DISTRIBUTION OF GRAPEVINE VIRUS D IN TUNISIAN GRAPEVINES

Rugose wood is a complex disease affecting grapevine worldwide. At present, at least six different viruses belonging to the family Betaflexiviridae are known to be associated with the disease (Saldarelli, 2014). Previous studies had shown that Grapevine virus A (GVA), Grapevine virus B (GVB) and Grapevine rupestris stem pitting associated virus (GRSPaV) are common in Tunisian grapevines (Martelli, 2014), whereas no information is available on the presence of Grapevine virus D (GVD). Therefore, a total of 140 samples from several cultivars, were collected from major Tunisian viticultural regions and tested for the presence of this virus by RT-PCR using the GVD-specific primers CP471C and CP7V (Abou-Ghanem et al., 1997). A 474 bp product corresponding to a fragment of the coat protein gene was amplified from 58 samples, accounting for an infection rate of 41.42%. The virus was present in all the surveyed areas and grape cultivars tested. The infection rate ranged from 11.7% (cv. Red Globe) to 88.8% (cv. Muscat RafRaf). To confirm the identity of the target virus, three RT-PCR products were cloned and sequenced. The Tunisian isolates shared 86-91% common nucleotides with the other GVD isolates from GenBank, and 72-73%, 60-62% and 53-55% nucleotide identity with GVA (JF754577), GVB (NC003602.1) and GVE (JX402759.1), respectively. To our knowledge, this is the first report on the occurrence of GVD in Tunisian grapevines. The infection rate of GVD (41.42%), which is close to that of GVA (47.2%) in the same samples, suggests the presence of common vectors for both viruses in Tunisian vineyards.

First report of grapevine Rupestris stem pitting-associated virus in wild grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia...

Incidence and distribution of viruses in Tunisian fig orchards.

A survey for viruses was carried out in the main fig-growing areas of Tunisia and in a fig germplasm collection at the Institut Superieure Agronomique de Chatt Mariem of Sousse. A total of 232 leaf samples were collected randomly from symptomatic and symptomless fig trees of 26 cultivars, and tested by RT-PCR for the presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FMMaV-2), Fig mild mottle-associated virus (FMMaV), Fig cryptic virus (FCV), Fig fleck-associated virus (FFkaV) and Fig latent virus 1 (FLV-1), using specific sets of primers. About 62.1% of the samples tested were found to be infected by at least one virus. FMV was the prevailing virus with a 34.5% incidence, followed by FLV-1 (32.4%), FMMaV (10.7%), FLMaV-1 (10.3%), FFkaV (10.3%), FCV (9.9%) and FLMaV-2 (4.3%). The highest infection rate was observed in Sfax (100%), followed by Takelsa (73.4%), Djebba (70.2%), Sousse (66.6%), Mornag (54.4%) and Rafraf (50%), whereas it was moderate in Sidi Fraj (23.3%). Among all viruses detected, FMV was the most widespread, especially in Djebba (51.3%), Sfax (50%) and Takelsa (40.6%). According to the fig varieties, the highest infection rates were in the commercial cvs. Hamouri (87.5%), Bayoudhi (75%), Bouhouli (70.3%), Zidi (54.2%) Bither (53.8%), Bither Abyath (66.6%) and Soltani (69.2%). The results show the need to develop a clean stock program to prevent the dissemination of fig-infecting viruses associated with Fig mosaic disease in Tunisia.

OCCURRENCE OF FIG MOSAIC VIRUS IN TUNISIAN FIG ORCHARDS

The symptomatology of fig mosaic disease is extremely vari- able. The causal agent of the disease was unknown for a long time (Martelli, 2011), until enveloped round to ovoid bodies known as double membrane bodies (DMBs) were found consis- tently associated with mosaic symptoms. DMBs were successfully transmitted by the eriophyd mite Aceria ficus (Martelli, 2011), and eventually identified as the putative particles of Fig mosaic virus (FMV) (Elbeaino et al., 2009). In spring 2011 a survey of fig orchards was carried out in four different areas of north Tunisia (Cap Bon, Mornag, Beja, Rafraf) to assess the presence and prevalence of FMV. A range of foliar symptoms, including vari- ous types of chlorotic mottling and blotching, crinkling, vein clearing, vein banding, vein feathering, ring spots, line patterns and malformations, were observed in all the fields surveyed. Symptomatic leaf samples were collected from fig trees and test- ed by RT-PCR using FMV-specific primers (E5-s CGGTAG- CAAATGGAATGAAA) and (E5-a-AACACTGTTTTTGC- GATTGG). A 302 pb DNA fragment of RNA-1 (Elbeaino et al., 2009) was obtained from 35% (62 out of 175) of the samples tested. The virus was widely distributed in cvs Zidi (54%), Bouhouli (52%), Bayoudhi (25%) and Bither (20%). Mosaic-like symptoms were also present in 63 of 143 samples that were PCR- negative for FMV. This last finding further supports the complex nature of fig mosaic disease in whose aetiology FMV plays a sig- nificant but likely not exclusive role (Martelli, 2011). To our knowledge, this is the first record of FMV in Tunisia.

GENETIC VARIABILITY OF RNA-1, RNA-2 AND RNA-3 OF FIG MOSAIC VIRUS ISOLATES FROM TUNISIA

A brief account is given of the genetic variability of Fig mosaic virus (FMV) in Tunisia. The analysis of 10 isolates from different fig cultivars and areas of the country has shown nucleotide sequence identities ranging between 90-99% in RNA-1 (302 bp analyzed), 93-99% in RNA-2 (234 bp) and 96-100% in RNA-3 (304 bp). These identity levels decreased to 86%, 90% and 93% for RNA-1, -2 and -3, respectively, when isolates from other geographical areas were included in the analysis. In the phylogenetic tree constructed with partial sequences of RNA-3 of 34 different FMV isolates (13 from this study and 21 from GenBank), the isolates separated into four distinct clades according to their geographic origin: clade I included isolates from Turkey and Israel; clade II included isolates from North America (California and Canada), Japan and Turkey; clade III grouped all Tunisian isolates and those from other Mediterranean countries (Italy, Algeria, Lebanon and France); and clade IV included only Serbian isolates. The preliminary comparative analysis conducted on three RNA segments of FMV highlighted that RNA-3, which codes for the viral nucleoprotein, is the most conserved, being subjected to a strong negative selection.

GENETIC DIVERSITY OF GRAPEVINE LEAFROLL-ASSOCIATED VIRUS 3 IN ALGERIA

Several vineyards and a Vitis germplasm collection were surveyed in Algeria for the presence Grapevine leafroll-associated virus 3 (GLRaV-3) by DAS-ELISA. The virus was found in almost half (44%) of the samples tested (212 out of 484). The genetic diversity of selected GLRaV-3 isolates was determined by characterizing fragments of the heat shock 70 protein homologue (HSP70h) and coat protein (CP) genes by single-strand conformation polymorphism (SSCP) and sequencing. Algerian GLRaV-3 isolates showed three SSCP patterns and belonged to previously described phylogenetic groups I, II and III. Analysis of phylogenetic trees obtained with partial HSP70h gene sequences suggested the existence of two new subgroups and confirmed a few stand-alone variants. To the best of our knowledge, this is the first characterization of GLRaV-3 isolates from Algeria.

MOLECULAR VARIABILITY OF PRUNUS NECROTIC RINGSPOT VIRUS ISOLATES FROM DIFFERENT PRUNUS HOSTS IN TUNISIA

Prunus necrotic ringspot virus (PNRSV) was detected by PCR in Tunisian stone fruit germplasm collections. Peach had the highest infection rate reaching 50%, followed by apricot (46.8%), almond (35.5%) and plum (9.5%). The genetic variability of the CP gene of 10 P N R S V isolates was evaluated by SSCP analysis of PCR products and analysis of their sequence. I n phylogenetic trees, Tunisian PNRSV isolates c l u s t e r e d in the three major groups, PV96, PV32 and PE5. However, an almond isolate (AlTun8) segregated as an out-group. This isolate is phylogenetically distant from other PNRSV isolates from different parts of the world and displays nucleic and amino acid identities of 83-86% and 65-74%, respectively, with PV96, PE5 and PV32. This is the first report on the molecular variability of PNRSV in different Prunus hosts in Tunisia.

PRESENCE OF FIG MILD MOTTLE- ASSOCIATED VIRUS AND FIG LATENT VIRUS 1 IN TUNISIA

A wide range of foliar symptoms including deformations, mosaic, chlorotic mottling, blotching, vein banding, clear- ing, feathering and chlorotic ringspots, as well as chlorotic ringspots on immature fruits were observed in Tunisian fig trees. The objective of this study was to survey fig orchards for the presence of Fig mild mottle-associated virus (FMMaV) and Fig latent virus 1 (FLV1). Eighty symptomatic and symp- tomless fig trees located at Takelsa, Sousse, Sfax and Morneg were collected in spring 2012. Total nucleic acids were ex- tracted from leaf tissue with the silica capture protocol (Fois- sac et al., 2000) and used in RT-PCR with specific prim- ers (i) FMMaV-s 5’ AAGGGGAATCTACAAGGGTCG 3’ and FMMaV-a 5’ TATTACGCGCTTGAGGATTGC 3 for the amplification of a 311 bp fragment from the heat shock protein 70 homologue gene (Elbeaino et al., 2010); and (ii) FLV1-s 5’ CCATCTTCACCACACAAATGTC 3’ and FLV1-a 5’ CAATCTTCTTGGCCTCCATAAG 3’ for the amplifica- tion of a 389 bp segment from the coat protein gene (Gattoni et al., 2009). Results disclosed 12 FMMaV-positive samples (14%) in Takelsa (5%), Morneg (1%) and Sousse (9%) but not in Sfax while FLV-1 occurred in all surveyed areas (44%) with the highest prevalence in Takelsa (19%) followed by Morneg (10%), Sousse (9%) and Sfax (6%). FMMaV-infected plants showed mild mottling and leaf deformations compa- rable to those observed in Italy on accession Cal-1 (Elbeaino et al., 2010). FLV-1 was detected in symptomless as well as in symptomatic trees. To the best of our knowledge, this represents the first record of FMMaV and FLV1 in Tunisia.