Nicholas H. Heintz

REDOX-BASED REGULATION OF SIGNAL TRANSDUCTION: PRINCIPLES, PITFALLS, AND PROMISES

Oxidants are produced as a by-product of aerobic metabolism, and organisms ranging from prokaryotes to mammals have evolved with an elaborate and redundant complement of antioxidant defenses to confer protection against oxidative insults. Compelling data now exist demonstrating that oxidants are used in physiological settings as signaling molecules with important regulatory functions controlling cell division, migration, contraction, and mediator production. These physiological functions are carried out in an exquisitely regulated and compartmentalized manner by mild oxidants, through subtle oxidative events that involve targeted amino acids in proteins. The precise understanding of the physiological relevance of redox signal transduction has been hampered by the lack of specificity of reagents and the need for chemical derivatization to visualize reversible oxidations. In addition, it is difficult to measure these subtle oxidation events in vivo. This article reviews some of the recent findings that illuminate the significance of redox signaling and exciting future perspectives. We also attempt to highlight some of the current pitfalls and the approaches needed to advance this important area of biochemical and biomedical research.

Dynamic redox control of NF-kappaB through glutaredoxin-regulated S-glutathionylation of inhibitory kappaB kinase beta

The transcription factor NF-κB, a central regulator of immunity, is subject to regulation by redox changes. We now report that cysteine-179 of the inhibitory κB kinase (IKK) β-subunit of the IKK signalosome is a central target for oxidative inactivation by means of S-glutathionylation. S-glutathionylation of IKK-β Cys-179 is reversed by glutaredoxin (GRX), which restores kinase activity. Conversely, GRX1 knockdown sensitizes cells to oxidative inactivation of IKK-β and dampens TNF-α-induced IKK and NF-κB activation. Primary tracheal epithelial cells from Glrx1-deficient mice display reduced NF-κB DNA binding, RelA nuclear translocation, and MIP-2 (macrophage inflammatory protein 2) and keratinocyte-derived chemokine production in response to LPS. Collectively, these findings demonstrate the physiological relevance of the S-glutathionylation–GRX redox module in controlling the magnitude of activation of the NF-κB pathway.

The cell cycle is a redox cycle: linking phase-specific targets to cell fate.

Reactive oxygen species (ROS) regulate the strength and duration of signaling through redox-dependent signal transduction pathways via the cyclic oxidation/reduction of cysteine residues in kinases, phosphatases, and other regulatory factors. Signaling circuits may be segregated in organelles or other subcellular domains with distinct redox states, permitting them to respond independently to changes in the oxidation state of two major thiol reductants, glutathione and thioredoxin. Studies in yeast, and in complex eukaryotes, show that oscillations in oxygen consumption, energy metabolism, and redox state are intimately integrated with cell cycle progression. Because signaling pathways play specific roles in different phases of the cell cycle and the hierarchy of redox-dependent regulatory checkpoints changes during cell cycle progression, the effects of ROS on cell fate vary during the cell cycle. In G1, ROS stimulate mitogenic pathways that control the activity of cyclin-dependent kinases (CDKs) and phosphorylation of the retinoblastoma protein (pRB), thereby regulating S-phase entry. In response to oxidative stress, Nrf2 and Foxo3a promote cell survival by inducing the expression of antioxidant enzymes and factors involved in cell cycle withdrawal, such as the cyclin-dependent kinase inhibitor (CKI) p27. In S phase, ROS induce S-phase arrest via PP2A-dependent dephosphorylation of pRB. In precancerous cells, unconstrained mitogenic signaling by activated oncogenes induces replication stress in S phase, which activates the DNA-damage response and induces cell senescence. A number of studies suggest that interactions of ROS with the G1 CDK/CKI network play a fundamental role in senescence, which is considered a barrier to tumorigenesis. Adaptive responses and loss of checkpoint proteins such as p53 and p16(INK4a) allow tumor cells to tolerate constitutive mitogenic signaling and enhanced production of ROS, leading to altered redox status in many fully transformed cells. Alterations in oxidant and energy metabolism of cancer cells have emerged as fertile ground for new therapeutic targets. The present challenge is to identify redox-dependent targets relevant to each cell cycle phase, to understand how these targets control fate decisions, and to describe the mechanisms that link metabolism to cell cycle progression.

Asbestos, Lung Cancers, and Mesotheliomas: From Molecular Approaches to Targeting Tumor Survival Pathways

Fifteen years have passed since we published findings in the AJRCMB demonstrating that induction of early response fos/jun proto-oncogenes in rodent tracheal and mesothelial cells correlates with fibrous geometry and pathogenicity of asbestos. Our study was the first to suggest that the aberrant induction of signaling responses by crocidolite asbestos and erionite, a fibrous zeolite mineral associated with the development of malignant mesotheliomas (MMs) in areas of Turkey, led to altered gene expression. New data questioned the widely held belief at that time that the carcinogenic effects of asbestos in the development of lung cancer and MM were due to genotoxic or mutagenic effects. Later studies by our group revealed that proto-oncogene expression and several of the signaling pathways activated by asbestos were redox dependent, explaining why antioxidants and antioxidant enzymes were elevated in lung and pleura after exposure to asbestos and how they alleviated many of the phenotypic and functional effects of asbestos in vitro or after inhalation. Since these original studies, our efforts have expanded to understand the interface between asbestos-induced redox-dependent signal transduction cascades, the relationship between these pathways and cell fate, and the role of asbestos and cell interactions in development of asbestos-associated diseases. Of considerable significance is the fact that the signal transduction pathways activated by asbestos are also important in survival and chemoresistance of MMs and lung cancers. An understanding of the pathogenic features of asbestos fibers and dysregulation of signaling pathways allows strategies for the prevention and therapy of asbestos-related diseases.

Oxidation state governs structural transitions in peroxiredoxin II that correlate with cell cycle arrest and recovery.

Inactivation of eukaryotic 2-Cys peroxiredoxins (Prxs) by hyperoxidation has been proposed to promote accumulation of hydrogen peroxide (H2O2) for redox-dependent signaling events. We examined the oxidation and oligomeric states of PrxI and -II in epithelial cells during mitogenic signaling and in response to fluxes of H2O2. During normal mitogenic signaling, hyperoxidation of PrxI and -II was not detected. In contrast, H2O2-dependent cell cycle arrest was correlated with hyperoxidation of PrxII, which resulted in quantitative recruitment of ∼66- and ∼140-kD PrxII complexes into large filamentous oligomers. Expression of cyclin D1 and cell proliferation did not resume until PrxII-SO2H was reduced and native PrxII complexes were regenerated. Ectopic expression of PrxI or -II increased Prx-SO2H levels in response to oxidant exposure and failed to protect cells from arrest. We propose a model in which Prxs function as peroxide dosimeters in subcellular processes that involve redox cycling, with hyperoxidation controlling structural transitions that alert cells of perturbations in peroxide homeostasis.

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon☆

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

The identity and nuclear uptake of a cytosolic binding protein for 3-methylcholanthrene

Abstract The ability of 3-methylcholanthrene to interact noncovalently with rat liver cytosolic proteins was studied using Sephadex G200 chromatography. A specific 3-methylcholanthrene binding fraction from Sephadex G200 chromatography, termed peak B, when incubated with rat liver nuclei was able to translocate 3-methylcholanthrene into the nucleus. This translocation occurred faster and was quantitatively greater than the binding of 3-methylcholanthrene in buffer to nuclei. In addition, the nuclear uptake of peak B was increased by prewarming, suggesting that a heat-sensitive activation step may occur prior to the translocation process. However, no evidence was found on sucrose gradients for any conformational change in the protein fraction studied here. The translocation to the nucleus was temperature and time dependent. An examination of the characteristics of this 3-methylcholanthrene binding protein using Sephacryl S200 column chromatography showed a small number of high-affinity, saturable, binding sites to be present. These had an apparent dissociation constant, Kd, of 2.8 n m and a binding capacity of 770 fmol/mg of cytosolic protein. The selectivity of this protein was examined by competition studies and, in general, polycyclic hydrocarbons competed for the binding site, except for anthracene and phenanthrene. Of the inducers studied, 5,6-benzoflavone was a strong competitor. No competition was found with 12-O-tetradecanoyl phorbol-13-acetate, 2,6-ditertbutyl-p-cresol, β-retinyl acetate, or a number of steroids, except for 17β-estradiol which exhibited moderate binding. Peak B had a sedimentation coefficient of 4.2 S when analyzed on a linear sucrose gradient. Chromatography of peak B on a calibrated Sephacryl S200 column gave a molecular weight corresponding to 44,600 ± 4000.

An Extracellular Signal-Regulated Kinase 1- and 2-Dependent Program of Chromatin Trafficking of c-Fos and Fra-1 Is Required for Cyclin D1 Expression during Cell Cycle Reentry

ABSTRACT Mitogens activate cell signaling and gene expression cascades that culminate in expression of cyclin D1 during the G0-to-G1 transition of the cell cycle. Using cell cycle arrest in response to oxidative stress, we have delineated a dynamic program of chromatin trafficking of c-Fos and Fra-1 required for cyclin D1 expression during cell cycle reentry. In serum-stimulated lung epithelial cells, c-Fos was expressed, recruited to chromatin, phosphorylated at extracellular signal-regulated kinase 1- and 2 (ERK1,2)-dependent sites, and degraded prior to prolonged recruitment of Fra-1 to chromatin. Immunostaining showed that expression of nuclear c-Fos and that of cyclin D1 are mutually exclusive, whereas nuclear Fra-1 and cyclin D1 are coexpressed as cells traverse G1. Oxidative stress prolonged the accumulation of phospho-ERK1,2 and phospho-c-Fos on chromatin, inhibited entry of Fra-1 into the nucleus, and blocked cyclin D1 expression. After induction of the immediate-early gene response in the presence of oxidative stress, inhibition of ERK1,2 signaling promoted degradation of c-Fos, recruitment of Fra-1 to chromatin, and expression of cyclin D1. Our data indicate that termination of nuclear ERK1,2 signaling is required for an exchange of Fra-1 for c-Fos on chromatin and initiation of cyclin D1 expression at the G0-to-G1 transition of the cell cycle.

Cooperation of E2F-p130 and Sp1-pRb Complexes in Repression of the Chinese Hamster dhfr Gene

ABSTRACT In mammalian cells reiterated binding sites for Sp1 and two overlapping and inverted E2F sites at the transcription start site regulate the dhfr promoter during the cell growth cycle. Here we have examined the contributions of the dhfr Sp1 and E2F sites in the repression of dhfr gene expression. In serum-starved cells or during serum stimulation, the Chinese hamsterdhfr gene was not derepressed by trichostatin A (TSA), an inhibitor of histone deacetylases (HDAC). Immunoprecipitation experiments showed that HDAC1 and hypophosphorylated retinoblastoma protein (pRb) are associated with Sp1 in serum-starved CHOC400 cells. In transfection experiments, reporter plasmids containing the reiterated dhfr Sp1 sites were stimulated 10-fold by TSA, while a promoter containing four dhfr E2F sites and a TATA box was responsive to E2F but was completely unaffected by TSA. HDAC1 did not coprecipitate with p130-E2F DNA binding complexes, the predominant E2F binding activity in cell extracts after serum starvation, suggesting that p130 imposes a TSA-insensitive state on thedhfr promoter. In support of this notion, recruitment of GAL4-p130 to a dihydrofolate reductase-GAL4 reporter rendered the promoter insensitive to TSA, while repression by GAL4-pRb was sensitive to TSA. Upon phosphorylation of pRb and p130 after serum stimulation, the Sp1-pRb and p130-E2F interactions were lost while the Sp1-HDAC1 interaction persisted into S phase. Together these studies suggest a dynamic model for the cooperation of pRb and p130 in repression ofdhfr gene expression during withdrawal from the cell cycle. We propose that, during initial phases of cell cycle withdrawal, the binding of dephosphorylated pRb to Sp1-HDAC1 complexes and complexes of E2F-1 -to -3 with DP results in transient, HDAC-dependent suppression of dhfr transcription. Upon withdrawal of cells into G0, recruitment of p130 to E2F-4–DP-1 complexes at the transcription start site results in a TSA-insensitive complex that cooperates with Sp1-HDAC-pRb complexes to stably repressdhfr promoter activity in quiescent cells.

Gene expression profiles reveal increased mClca3 (Gob5) expression and mucin production in a murine model of asbestos-induced fibrogenesis

To elucidate genes important in development or repair of asbestos-induced lung diseases, gene expression was examined in mice after inhalation of chrysotile asbestos for 3, 9, and 40 days. We identified changes in the expression of genes linked to proliferation (cyclin B2, CDC20, and CDC28 protein kinase regulatory subunit 2), inflammation (CCL9, CCL6, complement component 1, chitinase3-like 3, TNF superfamily member 10, and IL-1B), and matrix remodeling (MMP12, MMP3, integrin alphaX, and cathepsins K, Z, B, and S). The most highly induced gene at all time points was mclca3 (gob5), a putative calcium-activated chloride channel involved in the regulation of mucus production and/or secretion. Using histochemistry, we demonstrated accumulation of mucus and increased mClca3 protein in the bronchiolar epithelium of asbestos-exposed mice at all time points but peaking at 9 days. Cytokine levels (interleukin-1beta, interleukin-4, interleukin-6) in bronchoalveolar lavage fluid also increased at 9 days, suggesting Th2-mediated immunity may play a role in asbestos-induced mucus production. In contrast, levels of cathepsin K, a potent elastase, increased between 3 and 40 days at both the mRNA and protein levels, localizing primarily in CD45-positive leukocytes and interstitial cells. Identification of genes involved in lung injury and remodeling after asbestos exposure could aid in defining mechanisms of airborne particulate-induced disease and in developing therapeutic strategies.