Norman A. Doggett

Comparison of human genetic and sequence-based physical maps

Recombination is the exchange of information between two homologous chromosomes during meiosis. The rate of recombination per nucleotide, which profoundly affects the evolution of chromosomal segments, is calculated by comparing genetic and physical maps. Human physical maps have been constructed using cytogenetics, overlapping DNA clones and radiation hybrids; but the ultimate and by far the most accurate physical map is the actual nucleotide sequence. The completion of the draft human genomic sequence provides us with the best opportunity yet to compare the genetic and physical maps. Here we describe our estimates of female, male and sex-average recombination rates for about 60% of the genome. Recombination rates varied greatly along each chromosome, from 0 to at least 9 centiMorgans per megabase (cM Mb-1). Among several sequence and marker parameters tested, only relative marker position along the metacentric chromosomes in males correlated strongly with recombination rate. We identified several chromosomal regions up to 6 Mb in length with particularly low (deserts) or high (jungles) recombination rates. Linkage disequilibrium was much more common and extended for greater distances in the deserts than in the jungles.

Pathogenomic Sequence Analysis of Bacillus cereus and Bacillus thuringiensis Isolates Closely Related to Bacillus anthracis

Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis are closely related gram-positive, spore-forming bacteria of the B. cereus sensu lato group. While independently derived strains of B. anthracis reveal conspicuous sequence homogeneity, environmental isolates of B. cereus and B. thuringiensis exhibit extensive genetic diversity. Here we report the sequencing and comparative analysis of the genomes of two members of the B. cereus group, B. thuringiensis 97-27 subsp. konkukian serotype H34, isolated from a necrotic human wound, and B. cereus E33L, which was isolated from a swab of a zebra carcass in Namibia. These two strains, when analyzed by amplified fragment length polymorphism within a collection of over 300 of B. cereus, B. thuringiensis, and B. anthracis isolates, appear closely related to B. anthracis. The B. cereus E33L isolate appears to be the nearest relative to B. anthracis identified thus far. Whole-genome sequencing of B. thuringiensis 97-27and B. cereus E33L was undertaken to identify shared and unique genes among these isolates in comparison to the genomes of pathogenic strains B. anthracis Ames and B. cereus G9241 and nonpathogenic strains B. cereus ATCC 10987 and B. cereus ATCC 14579. Comparison of these genomes revealed differences in terms of virulence, metabolic competence, structural components, and regulatory mechanisms.

Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Analysis of the neurotoxin complex genes in Clostridium botulinum A1-A4 and B1 strains: BoNT/A3, /Ba4 and /B1 clusters are located within plasmids.

Background Clostridium botulinum and related clostridial species express extremely potent neurotoxins known as botulinum neurotoxins (BoNTs) that cause long-lasting, potentially fatal intoxications in humans and other mammals. The amino acid variation within the BoNT is used to categorize the species into seven immunologically distinct BoNT serotypes (A–G) which are further divided into subtypes. The BoNTs are located within two generally conserved gene arrangements known as botulinum progenitor complexes which encode toxin-associated proteins involved in toxin stability and expression. Methodology/Principal Findings Because serotype A and B strains are responsible for the vast majority of human botulism cases worldwide, the location, arrangement and sequences of genes from eight different toxin complexes representing four different BoNT/A subtypes (BoNT/A1-Ba4) and one BoNT/B1 strain were examined. The bivalent Ba4 strain contained both the BoNT/A4 and BoNT/bvB toxin clusters. The arrangements of the BoNT/A3 and BoNT/A4 subtypes differed from the BoNT/A1 strains and were similar to those of BoNT/A2. However, unlike the BoNT/A2 subtype, the toxin complex genes of BoNT/A3 and BoNT/A4 were found within large plasmids and not within the chromosome. In the Ba4 strain, both BoNT toxin clusters (A4 and bivalent B) were located within the same 270 kb plasmid, separated by 97 kb. Complete genomic sequencing of the BoNT/B1 strain also revealed that its toxin complex genes were located within a 149 kb plasmid and the BoNT/A3 complex is within a 267 kb plasmid. Conclusions/Significance Despite their size differences and the BoNT genes they contain, the three plasmids containing these toxin cluster genes share significant sequence identity. The presence of partial insertion sequence (IS) elements, evidence of recombination/gene duplication events, and the discovery of the BoNT/A3, BoNT/Ba4 and BoNT/B1 toxin complex genes within plasmids illustrate the different mechanisms by which these genes move among diverse genetic backgrounds of C. botulinum.

A widely expressed transcription factor with multiple DNA sequence specificity, CTCF, is localized at chromosome segment 16q22.1 within one of the smallest regions of overlap for common deletions in breast and prostate cancers

The cellular protooncogene MYC encodes a nuclear transcription factor that is involved in regulating important cellular functions, including cell cycle progression, differentiation, and apoptosis. Dysregulated MYC expression appears critical to the development of various types of malignancies, and thus factors involved in regulating MYC expression may also play a key role in the pathogenesis of certain cancers. We have cloned one such MYC regulatory factor, termed CTCF, which is a highly evolutionarily conserved‐11‐zinc finger transcriptional factor possessing multiple DNA sequence specificity. CTCF binds to a number of important regulatory regions within the 5′ noncoding sequence of the human MYC oncogene, and it can regulate its transcription in several experimental systems. CTCF mRNA is expressed in cells of multiple different lineages. Enforced ectopic expression of CTCF inhibits cell growth in culture. Southern blot analyses and fluorescence in situ hybridization (FISH) with normal human metaphase chromosomes showed that the human CTCF is a single‐copy gene situated at chromosome locus 16q22. Cytogenetic studies have pointed out that chromosome abnormalities (deletions) at this locus frequently occur in many different human malignancies, suggesting the presence of one or more tumor suppressor genes in the region. To narrow down their localization, several loss of heterozygosity (LOH) studies of chromosome arm 16q in sporadic breast and prostate cancers have been carried out to define the most recurrent and smallest region(s) of overlap (SRO) for commonly deleted chromosome arm 16q material. For CTCF to be considered as a candidate tumor suppressor gene associated with tumorigenesis, it should localize within one of the SROs at 16q. Fine‐mapping of CTCF has enabled us to assign the CTCF gene to about a 2 centiMorgan (cM) interval of 16q22.1 between the somatic cell hybrid breakpoints CY130(D) and CY4, which is between markers D16S186 (16AC16‐101) and D16S496 (AFM214zg5). This relatively small region, containing the CTCF gene, overlaps the most frequently observed SROs for common chromosomal deletions found in sporadic breast and prostate tumors. In one of four analyzed paired DNA samples from primary breast cancer patients, we have detected a tumor‐specific rearrangement of CTCF exons encoding the 11‐zinc‐finger domain. Therefore, taken together with other CTCF properties, localization of CTCF to a narrow cancer‐associated chromosome region suggests that CTCF is a novel candidate tumor suppressor gene at 16q22.1. Genes Chromosomes Cancer 22:26–36, 1998.

Integration of high-resolution array comparative genomic hybridization analysis of chromosome 16q with expression array data refines common regions of loss at 16q23-qter and identifies underlying candidate tumor suppressor genes in prostate cancer.

We have constructed a high-resolution genomic microarray of human chromosome 16q, and used it for comparative genomic hybridization analysis of 16 prostate tumors. We demarcated 10 regions of genomic loss between 16q23.1 and 16qter that occurred in five or more samples. Mining expression array data from four independent studies allowed us to identify 11 genes that were frequently underexpressed in prostate cancer and that co-localized with a region of genomic loss. Quantitative expression analyses of these genes in matched tumor and benign tissue from 13 patients showed that six of these 11 (WWOX, WFDC1, MAF, FOXF1, MVD and the predicted novel transcript Q9H0B8 (NM_031476)) had significant and consistent downregulation in the tumors relative to normal prostate tissue expression making them candidate tumor suppressor genes.

High-Resolution Cytogenetic-Based Physical Map of Human Chromosome 16

A panel of 54 mouse/human somatic cell hybrids, each possessing various portions of chromosome 16, was constructed; 46 were constructed from naturally occurring rearrangements of this chromosome, which were ascertained in clinical cytogenetics laboratories, and a further 8 from rearrangements spontaneously arising during tissue culture. By mapping 235 DNA markers to this panel of hybrids, and in relation to four fragile sites and the centromere, a cytogenetic-based physical map of chromosome 16 with an average resolution of 1.6 Mb was generated. Included are 66 DNA markers that have been typed in the CEPH pedigrees, and these will allow the construction of a detailed correlation of the cytogenetic-based physical map and the genetic map of this chromosome. Cosmids from chromosome 16 that have been assembled into contigs by use of repetitive sequence fingerprinting have been mapped to the hybrid panel. Approximately 11% of the euchromatin is now both represented in such contigs and located on the cytogenetic-based physical map. This high-resolution cytogenetic-based physical map of chromosome 16 will provide the basis for the cloning of genetically mapped disease genes, genes disrupted in cytogenetic rearrangements that have produced abnormal phenotypes, and cancer breakpoints.

Evaluation of a cosmid contig physical map of human chromosome 16

A cosmid contig physical map of human chromosome 16 has been developed by repetitive sequence finger-printing of approximately 4000 cosmid clones obtained from a chromosome 16-specific cosmid library. The arrangement of clones in contigs is determined by (1) estimating cosmid length and determining the likelihoods for all possible pairwise clone overlaps, using the fingerprint data, and (2) using an optimization technique to fit contig maps to these estimates. Two important questions concerning this contig map are how much of chromosome 16 is covered and how accurate are the assembled contigs. Both questions can be addressed by hybridization of single-copy sequence probes to gridded arrays of the cosmids. All of the fingerprinted clones have been arrayed on nylon membranes so that any region of interest can be identified by hybridization. The hybridization experiments indicate that approximately 84% of the euchromatic arms of chromosome 16 are covered by contigs and singleton cosmids. Both grid hybridization (26 contigs) and pulsed-field gel electrophoresis experiments (11 contigs) confirmed the assembled contigs, indicating that false positive overlaps occur infrequently in the present map. Furthermore, regional localization of 93 contigs and singleton cosmids to a somatic cell hybrid mapping panel indicates that there is no bias in the coverage of the euchromatic arms.

Identification of Alu‐mediated deletions in the Fanconi anemia gene FAA

Fanconi anemia (FA) is an autosomal recessive syndrome associated with hypersensitivity to DNA cross‐linking agents and predisposition to neoplasia. Eight complementation groups (A–H) have been described, but the only FA genes cloned so far are FAC and FAA. We have recently identified 40 different germline mutations, including microdeletions, microinsertions, and point mutations in genomic DNA from 97 FA patients from the International Fanconi Anemia Registry (IFAR) by single‐strand conformational polymorphism (SSCP) analysis. Interestingly, only one mutant allele was identified in many of these patients. Haplotype analysis with intragenic polymorphisms, as well as cDNA analysis of some patients suggested the presence of large deletions that would not be detected by SSCP analysis. In this study, we report the occurrence of Alu‐mediated genomic deletions in FAA. Two different deletions of 1.2 kb and 1.9 kb were found. Both deletions include exons 16 and 17 and remove a 156‐bp segment from the transcript causing a shorter in‐frame message. Sequence analysis revealed that introns 15 and 17 are rich in partial and complete Alu repeats. There are at least four head‐to‐tail arranged Alu elements in intron 17 and one in intron 15, all oriented in the 3′ → 5′ direction. Sequence analysis of the deletions showed that the 5′ breakpoints occurred at different sites in the same Alu element in intron 15, while the 3′ breakpoints were located in different Alu repeats in intron 17. Numerous Alu repeats are present in FAA, suggesting that Alu‐mediated recombination might be an important mechanism for the generation of FAA mutations. Hum Mutat 12:145–152, 1998.

A 360-kb interchromosomal duplication of the human HYDIN locus

The HYDIN gene located in human chromosome band 16q22.2 is a large gene encompassing 423 kb of genomic DNA that has been suggested as a candidate for an autosomal recessive form of congenital hydrocephalus. We have found that the human HYDIN locus has been very recently duplicated, with a nearly identical 360-kb paralogous segment inserted on chromosome 1q21.1. The duplication, among the largest interchromosomal segmental duplications described in humans, is not accounted for in the current human genome assembly and appears to be part of a greater than 550-kb contig that must lie within 1 of the 11 sequence gaps currently remaining in 1q21.1. Both copies of the HYDIN gene are expressed in alternatively spliced transcripts. Elucidation of the role of HYDIN in human disease susceptibility will require careful discrimination among the paralogous copies.