Patricia C. Zambryski

Ti plasmid vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity.

A Ti plasmid mutant was constructed in which all the on‐cogenic functions of the T‐DNA have been deleted and replaced by pBR322. This Ti plasmid, pGV3850, still mediates efficient transfer and stabilization of its truncated T‐DNA into infected plant cells. Moreover, integration and expression of this minimal T‐DNA in plant cells does not interfere with normal plant cell differentiation. A DNA fragment cloned in a pBR vector can be inserted in the pGV3850 T‐region upon a single recombination event through the pBR322 region of pGV3850 producing a co‐integrate useful for the transformation of plant cells. Based upon these properties, pGV3850 is proposed as an extremely versatile vector for the introduction of any DNA of interest into plant cells.

The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein

The P30 protein of tobacco mosaic virus (TMV) is required for cell to cell movement of viral RNA, which presumably occurs through plant intercellular connections, the plasmodesmata. The mechanism by which P30 mediates transfer of TMV RNA molecules through plasmodesmata channels is unknown. We have identified P30 as an RNA and single-stranded (ss) DNA binding protein. Binding of purified P30 to ss nucleic acids is strong, highly cooperative, and sequence nonspecific with a minimal binding site of 4-7 nucleotides per P30 monomer. In-frame deletions across P30 were used to localize the ss nucleic acid binding domain to within amino acid residues 65-86 of the protein. We propose that binding of P30 to TMV RNA creates an unfolded protein-RNA complex that functions as an intermediate in virus cell to cell movement through plasmodesmata.

Expression of foreign genes in regenerated plants and in their progeny.

Chimeric genes comprised of the nopaline synthase promoter and bacterial coding sequences specifying resistance to kanamycin, chloramphenicol or methotrexate, were inserted into the non‐oncogenic Ti plasmid vector pGV3850 by recombination (through homologous pBR322 sequences present in the chimeric gene constructs and pGV3850). These co‐integrates in Agrobacterium were used to infect single plant protoplasts of Nicotiana by co‐cultivation. The resistance traits allowed the selection of transformed calli in tissue culture in the presence of the appropriate antibiotic. Furthermore, as a non‐oncogenic Ti plasmid was used for the protoplast transformation, phenotypically normal and fertile plants could be regenerated from the resistant calli. We have shown that these fully differentiated plant tissues exhibit functional expression of resistance traits (KmR and CmR). All plants carrying the chimeric genes developed normally, flowered, and set seeds. The inheritance of several of these resistance traits was analyzed and shown to be Mendelian. These results are model experiments to demonstrate that genes of interest can be systematically transferred to the genome of plants using non‐oncogenic Ti plasmid derivatives; and that transformed plants are capable of normal growth and differentiation, thus providing a natural environment for the study of gene expression and development of plant cells.

Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells.

Tobacco mosaic virus movement protein P30 complexes with genomic viral RNA for transport through plasmodesmata, the plant intercellular connections. Although most research with P30 focuses on its targeting to and gating of plasmodesmata, the mechanisms of P30 intracellular movement to plasmodesmata have not been defined. To examine P30 intracellular localization, we used tobacco protoplasts, which lack plasmodesmata, for transfection with plasmids carrying P30 coding sequences under a constitutive promoter and for infection with tobacco mosaic virus particles. In both systems, P30 appears as filaments that colocalize primarily with microtubules. To a lesser extent, P30 filaments colocalize with actin filaments, and in vitro experiments suggested that P30 can bind directly to actin and tubulin. This association of P30 with cytoskeletal elements may play a critical role in intracellular transport of the P30-viral RNA complex through the cytoplasm to and possibly through plasmodesmata.

Transfer of T-DNA from Agrobacterium to the Plant Cell

Agrobacterium tumefaciens is the causative agent of crown gall, a disease of dicotyledonous plants characterized by a tumorous phenotype. Earlier in this century, scientific interest in A. tumefaciens was based on the possibility that the study of plant tumors might reveal mechanisms that were also operating in animal neoplasia. In the recent past, the tumorous growth was shown to result from the expression of genes coded for by a DNA segment of bacterial origin that was transferred and became stably integrated into the plant genome. This initial molecular characterization of the infection process suggested that Agrobacterium might be used to deliver genetic material into plants. The potential to genetically engineer plants generated renewed interest in the study of A. tumefaciens. In this review, we concentrate on the most recent advances in the study of Agrobacterium-mediated gene transfer, its relationship to conjugation, DNA processing and transport, and nuclear targeting. In the following discussion, references for earlier work can be found in more comprehensive reviews (Hooykaas and Schilperoort, 1992; Zambryski, 1992; Hooykaas and Beijersbergen, 1994).

Right 25 by terminus sequence of the nopaline t-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.

RRB1 AND RRB2 ENCODE MAIZE RETINOBLASTOMA-RELATED PROTEINS THAT INTERACT WITH A PLANT D-TYPE CYCLIN AND GEMINIVIRUS REPLICATION PROTEIN

Unlike mammalian and yeast cells, little is known about how plants regulate G1 progression and entry into the S phase of the cell cycle. In mammalian cells, a key regulator of this process is the retinoblastoma tumor suppressor protein (RB). In contrast, G1 control in Saccharomyces cerevisiae does not utilize an RB-like protein. We report here the cloning of cDNAs from two Zea mays genes, RRB1 and RRB2, that encode RB-related proteins. Further, RRB2 transcripts are alternatively spliced to yield two proteins with different C termini. At least one RRB gene is expressed in all the tissues examined, with the highest levels seen in the shoot apex. RRB1 is a 96-kDa nuclear protein that can physically interact with two mammalian DNA tumor virus oncoproteins, simian virus 40 large-T antigen and adenovirus E1A, and with a plant D-type cyclin. These associations are abolished by mutation of a conserved cysteine residue in RRB1 that is also essential for RB function. RRB1 binding potential is also sensitive to deletions in the conserved A and B domains, although differences exist in these effects compared to those of human RB. RRB1 can also bind to the AL1 protein from tomato golden mosaic virus (TGMV), a protein which is essential for TGMV DNA replication. These results suggest that G1 regulation in plant cells is controlled by a mechanism which is much more similar to that found in mammalian cells than that in yeast.

virA and virG control the plant-induced activation of the T-DNA transfer process of A. tumefaciens

The Ti plasmid vir loci of Agrobacterium tumefaciens are transcriptionally activated in response to signal molecules produced by plant cells to initiate the T-DNA transfer process. We show that the pTiA6 vir loci are organized as a single regulon whose induction by plants is controlled by virA and virG. Mutations in virA result in attenuated induction. This locus is constitutively transcribed and noninducible. Mutations in virG eliminate vir induction. This locus is constitutively transcribed, plant-inducible, and self-regulated in a complex fashion, and it produces two distinct and differentially regulated transcripts. virA is proposed to encode a transport protein for the plant signal molecule, and virG a positive regulatory protein that together with the plant molecule activates vir expression.

Modes of intercellular transcription factor movement in the Arabidopsis apex.

A recent and intriguing discovery in plant biology has been that some transcription factors can move between cells. In Arabidopsis thaliana, the floral identity protein LEAFY has strong non-autonomous effects when expressed in the epidermis, mediated by its movement into underlying tissue layers. By contrast, a structurally unrelated floral identity protein, APETALA1, has only limited non-autonomous effects. Using GFP fusions to monitor protein movement in the shoot apical meristem and in floral primordia of Arabidopsis, we found a strong correlation between cytoplasmic localization of proteins and their ability to move to adjacent cells. The graded distribution of several GFP fusions with their highest levels in the cells where they are produced is compatible with the notion that this movement is driven by diffusion. We also present evidence that protein movement is more restricted laterally within layers than it is from L1 into underlying layers of the Arabidopsis apex. Based on these observations, we propose that intercellular movement of transcription factors can occur in a non-targeted fashion as a result of simple diffusion. This hypothesis raises the possibility that diffusion is the default state for many macromolecules in the Arabidopsis apex, unless they are specifically retained.

Subcellular localization determines the availability of non-targeted proteins to plasmodesmatal transport

BACKGROUND Individual plant cells are encased in a cell wall. To enable cell-to-cell communication, plants have evolved channels, termed plasmodesmata, to span thick walls and interconnect the cytoplasm between adjacent cells. How macromolecules pass through these channels is now beginning to be understood. RESULTS Using two green fluorescent protein (GFP) reporters and a non-invasive transfection system, we assayed for intercellular macromolecular traffic in leaf epidermal cells. Plasmodesmata were found in different states of dilation. We could distinguish two forms of protein movement across plasmodesmata, non-targeted and targeted. Although leaves have generally been considered closed to non-specific transport of macromolecules, we found that 23% of the cells had plasmodesmatal channels in a dilated state, allowing GFP that was not targeted to plasmodesmata to move into neighboring cells. GFP fusions that were targeted to the cytoskeleton or to the endoplasmic reticulum did not move between cells, whereas those that were localized to the cytoplasm or nucleus diffused to neighboring cells in a size-dependent manner. Superimposed upon this non-specific exchange, proteins that were targeted to the plasmodesmata could transit efficiently between 62% of transfected cells. CONCLUSIONS A significant population of leaf cells contain plasmodesmata in a dilated state, allowing macromolecular transport between cells. Protein movement potential is regulated by subcellular address and size. These parameters of protein movement illustrate how gradients of signaling macromolecules could be formed and regulated, and suggest that non-cell-autonomous development in plants may be more significant than previously assumed.