Patrick J Kirby

DMRT1 in a ratite bird: evidence for a role in sex determination and discovery of a putative regulatory element

Unlike mammals, birds have a ZZ male/ZW female sex-determining system. In most birds, the Z is large and gene rich, whereas the W is small and heterochromatic, but the ancient group of ratite birds are characterized by sex chromosomes that are virtually homomorphic. Any gene differentially present on the ratite Z and W is therefore a strong candidate for a sex-determining role. We have cloned part of the candidate bird sex-determining gene DMRT1 from the emu, a ratite bird, and have shown that it is expressed during the stages of development corresponding to gonadal differentiation in the chicken. The gene maps to the distal region of the Z short arm and is absent from the large W chromosome. Because most sequences on the emu W chromosome are shared with the Z, the Z-specific location constitutes strong evidence that differential dosage of DMRT1 is involved in sex determination in all birds. The sequence of emu DMRT1 has 88% homology with chicken DMRT1 and 65% with human DMRT1. Unexpectedly, an unexpressed 270-bp region in intron 3 of emu DMRT1 showed 90% homology with a sequence in the corresponding intron of human DMRT1. This extraordinarily high conservation across 300 million years of evolution suggests an important function, perhaps involved in control of DMRT1 expression and vertebrate sex determination.

Sex determination in platypus and echidna: autosomal location of SOX3 confirms the absence of SRY from monotremes

In eutherian (‘placental’ mammals, sex is determined by the presence or absence of the Y chromosome-borne gene SRY, which triggers testis determination. Marsupials also have a Y-borne SRY gene, implying that this mechanism is ancestral to therians, the SRY gene having diverged from its X-borne homologue SOX3 at least 180 million years ago. The rare exceptions have clearly lost and replaced the SRY mechanism recently. Other vertebrate classes have a variety of sex-determining mechanisms, but none shares the therian SRY-driven XX female:XY male system. In monotreme mammals (platypus and echidna), which branched from the therian lineage 210 million years ago, no orthologue of SRY has been found. In this study we show that its partner SOX3 is autosomal in platypus and echidna, mapping among human X chromosome orthologues to platypus chromosome 6, and to the homologous chromosome 16 in echidna. The autosomal localization of SOX3 in monotreme mammals, as well as non-mammal vertebrates, implies that SRY is absent in Prototheria and evolved later in the therian lineage 210-180 million years ago. Sex determination in platypus and echidna must therefore depend on another male-determining gene(s) on the Y chromosomes, or on the different dosage of a gene(s) on the X chromosomes.

Autosomal location of genes from the conserved mammalian X in the platypus (Ornithorhynchus anatinus): Implications for mammalian sex chromosome evolution

Mammalian sex chromosomes evolved from an ancient autosomal pair. Mapping of human X- and Y-borne genes in distantly related mammals and non-mammalian vertebrates has proved valuable to help deduce the evolution of this unique part of the genome. The platypus, a monotreme mammal distantly related to eutherians and marsupials, has an extraordinary sex chromosome system comprising five X and five Y chromosomes that form a translocation chain at male meiosis. The largest X chromosome (X1), which lies at one end of the chain, has considerable homology to the human X. Using comparative mapping and the emerging chicken database, we demonstrate that part of the therian X chromosome, previously thought to be conserved across all mammals, was lost from the platypus X1 to an autosome. This region included genes flanking the XIST locus, and also genes with Y-linked homologues that are important to male reproduction in therians. Since these genes lie on the X in marsupials and eutherians, and also on the homologous region of chicken chromosome 4, this represents a loss from the monotreme X rather than an additional evolutionary stratum of the human X.

Cloning and mapping of platypus SOX2 and SOX14: Insights into SOX group B evolution

Group B SOX genes, the closest relatives to the sex-determining gene SRY, are thought to have evolved from a single ancestral SOX B by a series of duplications and translocations. The two SOX B genes SOX2 and SOX14 co-localize to chromosome 3q in humans. SOX2 and SOX14 homologues were cloned and characterized in the platypus, a monotreme mammal distantly related to man. The two genes were found to co-localize to chromosome 1q in this species. Proximity of the two related genes has therefore been conserved for 170 Myr, since humans and platypus diverged. The sequence similarity and conserved synteny of these group B genes provide clues to their origin. A simple model of SOX group B gene evolution is proposed.

Core-SINE blocks comprise a large fraction of monotreme genomes; implications for vertebrate chromosome evolution

The genomes of the egg-laying platypus and echidna are of particular interest because monotremes are the most basal mammal group. The chromosomal distribution of an ancient family of short interspersed repeats (SINEs), the core-SINEs, was investigated to better understand monotreme genome organization and evolution. Previous studies have identified the core-SINE as the predominant SINE in the platypus genome, and in this study we quantified, characterized and localized subfamilies. Dot blot analysis suggested that a very large fraction (32% of the platypus and 16% of the echidna genome) is composed of Mon core-SINEs. Core-SINE-specific primers were used to amplify PCR products from platypus and echidna genomic DNA. Sequence analysis suggests a common consensus sequence Mon 1-B, shared by platypus and echidna, as well as platypus-specific Mon 1-C and echidna specific Mon 1-D consensus sequences. FISH mapping of the Mon core-SINE products to platypus metaphase spreads demonstrates that the Mon-1C subfamily is responsible for the striking Mon core-SINE accumulation in the distal regions of the six large autosomal pairs and the largest X chromosome. This unusual distribution highlights the dichotomy between the seven large chromosome pairs and the 19 smaller pairs in the monotreme karyotype, which has some similarity to the macro- and micro-chromosomes of birds and reptiles, and suggests that accumulation of repetitive sequences may have enlarged small chromosomes in an ancestral vertebrate. In the forthcoming sequence of the platypus genome there are still large gaps, and the extensive Mon core-SINE accumulation on the distal regions of the six large autosomal pairs may provide one explanation for this missing sequence.

Assignment of the SMARCF1 gene to tammar wallaby chromosome 5q by fluorescence in situ hybridisation.

SWI/SNF-related, matrix associated, actin-dependent regulator of chromatin, subfamily f, member 1 (SMARCF1) is a member of a conserved family of proteins distinguished by a DNA binding motif called ARID (AT-rich interactive domain) (Dallas et al., 2000). First isolated in yeast, and followed by the characterization of similar SWI/SNF complexes in mammals and Drosophila melanogaster, these complexes have been suggested to play fundamental roles in the regulation of gene expression during cell growth and development via altering chromatin structure (Kingston and Narlikar, 1999; Kadonaga, 1998). SMARCF1 maps to human 1p36.1→p35 (Takeuchi et al., 1998) where it has been suggested that at least two tumor suppressor genes are located (Caron et al., 1995). In this study we cloned and mapped the genomic SMARCF1 in the model marsupial Macropus eugenii (tammar wallaby) of particular value for comparative genetics because of its early divergence (about 130 million years ago) from placental mammals. SMARCF1 was cloned and mapped by fluorescent in situ hybridization to the distal region of chromosome 5q. This is the first gene to be mapped to chromosome 5q in the tammar wallaby and may represent a region of homology between human chromosome 1 and wallaby chromosome 5.

Assignment of SOX1 to platypus chromosome 20q by fluorescence in situ hybridization.

A platypus ( Ornithorhynchus anatinus ) genomic BAC library (Clemson University Genomics Institute) was screened with a SOX3 probe amplifi ed by PCR from male platypus genomic DNA using the primers 5 CACAACTCGGAGATCAGCAA3 and 5 GTTGGTCCAGCCGTTGAC3 . Cycling parameters were: 94 ° C for 2 min, 35 cycles of 94 ° C for 30 s; 58 ° C for 30 s; 72 ° C for 1 min, then a fi nal cycle of 72 ° C for 10 min. A positive BAC clone was obtained (117-J7) and verifi ed by PCR using the previously described primers. Cycling parameters were: 94 ° C for 2 min, 35 cycles of 94 ° C for 30 s; 54 ° C for 30 s; 72 ° C for 1 min, then a fi nal cycle of 72 ° C for 10 min. The PCR product was sequenced and confi rmed to contain SOX1 . The positive BAC clone was labeled with digoxigenin-11-dUTP by nick translation, pre-annealed with 1 g platypus Cot-1 DNA and hybridized to male and female platypus metaphase chromosomes. Hybridization was detected with Cy3 conjugated to antidigoxigenin antibodies; chromosomes were counterstained with DAPI.

Assignment of the thymosin beta 4 X/Y chromosome (TMSB4X/Y) gene to tammar wallaby chromosome 5p by fluorescence in situ hybridisation

All mammals have an XX female:XY male sex chromosome system. The X and Y are thought to have evolved from a homologous pair of autosomes by a process of Y degradation. This process left a small, heterochromatic and gene-poor Y, and a relatively unchanged X chromosome (Ohno, 1967). The origin of the human sex chromosomes has been explored by comparing their gene content with that of sex chromosomes from distantly related mammals. Previous work has defined conserved (XCR, shared with the X of marsupials and monotremes) and added regions of the human X (XAR, homologous to marsupial and monotreme autosomal regions, represented by chromosome 5p in the tammar wallaby) (Watson et al., 1991; Spencer et al., 1991). As a degraded X, the Y also consists of conserved (YCR) and added (YAR) regions (Graves, 1995; Waters et al., 2001). We cloned and characterized the tammar wallaby homologue of TMSB4X (GenBank accession number AY341342), a gene with a copy on both the X and Y in human, and mapped it by fluorescent in situ hybridisation. No signals were found over the X or Y chromosome, but clear signals were apparent on chromosome 5p. This location is consistent with the hypothesis that the region of human Xp that includes TMSB4X was recently added (XAR), and that the human Y is largely derived from the same added region.

Assignment of the protocadherin 20 (PCDH20) gene to tammar wallaby chromosome 6q by fluorescence in situ hybridisation

Protocadherin genes are members of the cadherin superfamily and are thought to be involved in cell-cell recognition in the central nervous system. Cadherin genes are divided into two groups, classical and non-classical. Protocadherins are the major non-classical cadherins (Suzuki, 1996). In humans, PCDH20 maps to chromosome 13q21 (Yagi and Takeichi, 2000). PCDH20 is also known to map to mouse chromosome 18, rat chromosome 18p12→p11, and Chinese hamster chromosome 2q17 (Hirano et al., 1999, Ono et al., 2000). Marsupials are of particular value in comparative genetics because of their early divergence (about 130 million years ago) from eutherian mammals. In this study we cloned and mapped the genomic homologue of PCDH20 by fluorescence in situ hybridisation to the long arm of chromosome 6 in the model marsupial Macropus eugenii (tammar wallaby). PCDH20 is the first gene to be mapped to tammar wallaby chromosome 6 and may represent a newly defined region of homology between human chromosome 13 and wallaby chromosome 6. Secondary signals were also observed on the proximal region of the long arm of the X chromosome that could represent a related protocadherin gene in this region. Materials and methods