Paul C. Adams

Noninvasive prediction of fibrosis in C282Y homozygous hemochromatosis

BACKGROUND & AIMS The diagnosis of hemochromatosis is now possible for C282Y homozygous patients using noninvasive molecular genetic tests. The aim of this study was to define noninvasive factors predictive of severe fibrosis (bridging fibrosis or cirrhosis) to avoid unnecessary liver biopsies in such patients. METHODS Clinical and biological data were recorded at the time of diagnosis in 197 French C282Y homozygous patients, 52 (26%) of whom had severe fibrosis. Variables significantly linked to severe fibrosis using univariate analysis were entered into a multivariate stepwise analysis. These variables were combined to obtain a simple index allowing for prediction of severe fibrosis. RESULTS Serum ferritin, hepatomegaly, and serum aspartate aminotransferase were selected using multivariate analysis. Their combination applied to the 96 patients with ferritin level of </=1000 microgram/L, normal aspartate aminotransferase values, and absence of hepatomegaly showed that no severe fibrosis was encountered in this subgroup of patients. The results were validated in 113 C282Y homozygous patients in Canada with a good reproducibility of negative prediction but a poor reproducibility of the positive prediction of severe fibrosis. CONCLUSIONS In C282Y homozygous patients, the diagnosis of severe fibrosis relies on liver biopsy, but absence of severe fibrosis can be accurately predicted in most patients on the basis of simple clinical and biochemical variables.

Management of Hemochromatosis

Diagnosis and Initial Evaluation Diagnosis of Hemochromatosis Persons with hemochromatosis have an inherited propensity to absorb excess iron; most persons are of European origin and are homozygotes or compound heterozygotes for a mutant gene or genes on chromosome 6p [1, 2]. Hyperferremia and increased iron saturation of transferrin are essential attributes of hemochromatosis. A transferrin saturation of 60% or more for men and 50% or more for women on at least two occasions in the absence of other known causes of elevated transferrin saturation suggests the diagnosis of hemochromatosis [1, 2] and permits affected persons to be identified before iron overload develops. Normal or subnormal serum transferrin saturation values occur in unusual circumstances [3]. Many persons who have hemochromatosis without iron overload are children, young adults, and premenopausal women. Although iron overload often develops in patients with hemochromatosis, the demonstration of hepatic or systemic iron overload and associated complications is not needed to confirm the diagnosis (Table 1) [1, 2, 4]. Table 1. Evaluation of Patients with Hemochromatosis and Iron Overload Evaluation of Iron Overload Iron overload develops primarily because mechanisms to eliminate excess iron are limited. Many persons, particularly men, eventually develop severe iron overload. Women are at lower risk, partly because of iron losses during menstruation, childbirth, and lactation [1, 2]. The severity of iron overload is most often determined by measuring the serum ferritin level, although inflammation or cancer can elevate this level in the absence of iron overload. Approximately 90% of excess iron is retained in the liver. Therefore, many patients benefit from analysis of liver biopsy specimens to identify liver disease and to determine the presence or absence of cirrhosis, which directly affects prognosis. Biopsy specimens should be evaluated for iron by histochemical methods (Perls staining) and quantitative techniques (atomic absorption spectrometry) [4-7]. The quantity of iron removed by therapeutic phlebotomy is a valuable retrospective indicator of the severity of iron overload [8]. Radiologic imaging techniques are too insensitive for the evaluation of most young, asymptomatic persons with little or no excess hepatic iron [1, 2]. The hepatic iron index is useful in distinguishing persons who are homozygous for hemochromatosis from heterozygotes and persons with other hepatic disorders [5, 9]. Some patients have coincidental conditions that augment iron absorption and thus increase iron overload (for example, excessive dietary iron supplementation, excess ethanol ingestion, porphyria cutanea tarda, or hemolytic anemia) [1, 2, 10, 11]. Because serum iron variables in patients with viral hepatitis can mimic those in patients with hemochromatosis and because some patients have both disorders, persons with hemochromatosis must often be evaluated for hepatitis [12-14]. Medical Evaluation before Treatment From each patient, physicians should collect information that includes a review of current and past symptoms and health problems, especially those related to liver, joint, and heart disease; diabetes mellitus and other endocrinopathic conditions; sexual function; and skin pigmentation [1, 2]. A dietary history should focus on general dietary habits and food choices, use of dietary supplements, and ingestion of ethanol. Any history of blood donation, receipt of blood transfusion, and illness associated with blood loss should be documented. The details of menstruation, childbirth, lactation, menopause, and hysterectomy are important (women taking oral contraceptives may have decreased menstrual blood loss or may absorb less dietary iron). The history should include inquiries about family members, especially first-degree relatives. The physical examination must include assessment of the liver, joints, heart, endocrine status, and skin coloration. Certain sequelae of iron overload may require additional specific evaluations to assess management needs (Table 1). Therapeutic Phlebotomy Described in 1952, therapeutic phlebotomy was the first successful treatment for iron overload due to hemochromatosis [15] and is still the preferred treatment for this condition today [1, 2]. The removal of 1 unit of blood (450 to 500 mL) results in the loss of 200 to 250 mg of iron. Although iron chelation and erythrocytapheresis have also been used [16, 17], therapeutic phlebotomy is safer, more efficient, and more economical [1, 2]. Selection of Patients for Treatment Most persons with hemochromatosis benefit from therapeutic phlebotomy (Table 2). Rarely, children and adolescents have severe iron overload (often associated with cardiac and anterior pituitary failure) and need aggressive therapeutic phlebotomy for removal of 1.5 to 2.0 units weekly, if possible [18-20]. Withholding therapeutic phlebotomy from older patients on the basis of age alone is not justifiable. In asymptomatic persons with iron overload (Table 2), therapy must not be delayed until symptoms develop. However, some patients are not candidates for treatment because they are intolerant toward phlebotomy or have limited life expectancy. Patients with severe, refractory anemia require iron chelation therapy [21]. Table 2. Criteria for initiating Therapeutic Phlebotomy in Homozygotes or Heterozygotes for Hemochromatosis Gene or Genes and Other Persons with a Hemochromatosis Phenotype, Regardless of Genotype* Approximately 8% of white persons of western European descent inherit one detectable hemochromatosis gene and thus are heterozygotes [22]. Of the 1% to 3% of heterozygotes who develop iron overload [23], many have a coincidental disorder that increases iron absorption or alters iron metabolism [1, 2, 14]; others may have an additional hemochromatosis mutation or mutations undetectable by current testing methods [24]. Many persons with porphyria cutanea tarda have skin lesions that are alleviated with therapeutic phlebotomy, and many are heterozygous for HFE mutations [2, 25-27]. No study has shown the benefits of therapeutic phlebotomy in other persons with iron overload who are heterozygotes or compound heterozygotes for the hemochromatosis gene or genes. However, we recommend that all persons with iron overload who have a clinical phenotype consistent with hemochromatosis, regardless of genotype, receive therapeutic phlebotomy and management similar to that recommended for homozygotes for classic hemochromatosis (Table 2). Performance of Therapeutic Phlebotomy Therapeutic phlebotomy should be done by experienced persons and should be supervised by a physician. It is usually performed in a physicians office but can be done in a medical laboratory, a blood bank, or a patients home. However, comprehensive management of hemochromatosis is usually accomplished best in a physicians office. For many patients, compliance with treatment is proportional to the skill of the phlebotomist and the confidence of the patient in the treatment staff and environment. Adequate hydration and avoidance of vigorous physical activity for 24 hours after treatment minimize the effects of hypovolemia caused by therapeutic phlebotomy. Persons with a hemoglobin concentration less than 110 g/L or a hematocrit less than 0.33 before treatment are more likely to have symptoms of hypovolemia and anemia, and phlebotomy is less efficient in removing iron in these patients. However, many patients with chronic hemolytic anemia and iron overload tolerate phlebotomy well. The hemoglobin concentration or hematocrit and volume (or weight) of blood removed with each phlebotomy session should be documented. Frequency and Duration of Therapeutic Phlebotomy Depletion of iron stores typically involves the removal of 1 unit of blood weekly until mild hypoferritinemia occurs [1, 2]. Some men and persons with large body mass can sustain removal of 1.5 to 2.0 units of blood weekly. Some women; persons with small body mass; elderly persons; and patients with anemia, cardiac problems, or pulmonary problems can sustain removal of only 0.5 units of blood weekly. After a few weeks of therapeutic phlebotomy, erythroid hyperplasia permits more blood to be removed more often in many patients. Although recombinant human erythropoietin therapy also enhances erythrocyte production, this therapy should be reserved for patients who also have renal dysfunction or anemia of chronic disease [28]. Life expectancy may be substantially decreased in patients in whom iron depletion by phlebotomy cannot be completed within 1 year [29]. Serum ferritin and hepatic iron levels permit a relative estimation of the amount of therapeutic phlebotomy required for iron depletion [2]. On average, men require twice as many units of therapeutic phlebotomy as women do [24, 30, 31]. Older persons typically have more severe iron overload, as do persons who are homozygous for HFE mutation C282Y [2, 24, 32]. Hormonal factors, diet, abnormalities that alter iron absorption, and blood loss also influence the severity of iron overload [33]. Persons who have been regular blood donors often have less severe iron overload than do nondonors [1, 34]. The serum ferritin level is the most reliable, readily available, and inexpensive way to monitor therapeutic phlebotomy; the serum iron level and the transferrin saturation are less suitable [1, 2]. In general, patients who have higher serum ferritin levels have more severe iron overload and need more phlebotomy. Among patients who have serum ferritin levels greater than 1000 g/L before treatment, it is sufficient to quantify the serum ferritin level every 4 to 8 weeks during the initial months of treatment. The serum ferritin level should be measured more often in patients who have received many phlebotomy treatments and in those who have mild or moderate iron overload at diagnosis. In all patients, serum ferritin levels should be quantified a

Long-Term Survival Analysis in Hereditary Hemochromatosis

This study investigated the long-term survival rates of 85 patients with hereditary hemochromatosis. Eighty-five patients with documented hereditary hemochromatosis diagnosed between 1958 and 1989 and followed up at the University Hospital (University of Western Ontario) medical center were retrospectively reviewed for this analysis. The current status of the patient was assessed by interview or written questionnaire completed by the patient or the family physician. Estimates of differences in survival rates were obtained using Kaplan-Meier life-table and Cox regression analysis. Liver histology, clinical features of the disease, and number of venesections were analyzed to determine their relationship to survival. In the course of a mean follow-up interval of 8.1 +/- 6.8 years (range, 0-31 years), there were 17 deaths among the 85 hemochromatosis patients. Patients with cirrhosis at the time of diagnosis were 5.5 times more likely to die than noncirrhotic patients. Patients who were noncirrhotic at the time of diagnosis had an estimated survival that was not significantly different from age- and sex-matched members of the normal population. Diabetes did not increase the risk of death after data were controlled for the presence of cirrhosis. Early diagnosis and treatment of hemochromatosis in the precirrhotic stage can lead to long-term survival similar to that in the general population. The presence of cirrhosis significantly increases mortality and is the major clinical factor affecting survival.

A survey of 2,851 patients with hemochromatosis:: Symptoms and response to treatment

PURPOSE Hemochromatosis is a genetic disorder of iron absorption that affects 5 per 1,000 persons and is associated with reduced health and quality of life. We sought to determine the type and frequency of symptoms that patients experienced before the diagnosis and the treatments that they received. METHODS We mailed a questionnaire to 3,562 patients with hemochromatosis who were located using patient advocacy groups, physicians, blood centers, newsletters, and the Internet. RESULTS Of the 2,851 respondents, 99% were white and 62% were men. Circumstances that led to diagnosis of hemochromatosis included symptoms (35%), an abnormal laboratory test (45%), and diagnosis of a family member with hemochromatosis (20%). The mean (+/- SD) age of symptom onset was 41 +/- 14 years. Symptoms had been present for an average of 10 +/- 10 years before the diagnosis was made. Among the 58% of patients with symptoms, 65% had physician-diagnosed arthritis and 52% had liver disease. The most common and troublesome symptoms were extreme fatigue (46%), arthralgia (44%), and loss of libido (26%). Physician instructions to patients included treatment with phlebotomy (90%), testing family members (75%), and avoiding iron supplements (65%). CONCLUSIONS The diagnosis of hemochromatosis in most patients was delayed. Physician education is needed to increase the detection of patients with the disease and to improve its management.

Genotypic/phenotypic correlations in genetic hemochromatosis: Evolution of diagnostic criteria☆

BACKGROUND & AIMS The identification of a candidate gene for hereditary hemochromatosis in 69%-100% of patients with hemochromatosis has resulted in a diagnostic genotypic test (C282Y). The aim of this study was to reassess the phenotypic diagnostic criteria for hemochromatosis in patients homozygous for the C282Y mutation of the HFE gene. METHODS Transferrin saturation, ferritin, hepatic iron index, and iron removed by venesection were studied in C282Y++ homozygotes and C282Y-- putative homozygotes. RESULTS Patients were homozygous for the C282Y mutation in 122 of 128 cases (95%). In C282Y homozygotes, the results were as follows: hepatic iron index, >1.9 in 91.3%; transferrin saturation, >55% in 90%; serum ferritin, >300 microg/L in 96% of men and >200 microg/L in 97% of women; and iron removed, >5 g in 70% of men and 73% of women. There were four homozygotes for C282Y with no biochemical evidence of iron overload. CONCLUSIONS The sensitivity of the phenotypic tests in decreasing order was as follows: serum ferritin, hepatic iron index, transferrin saturation, and iron removed by venesection. Although the genetic test is useful in the diagnostic algorithm, this study has shown both iron-loaded patients without the mutation and homozygous patients without iron overload.

Polymorphism in intron 4 of HFE may cause overestimation of C282Y homozygote prevalence in haemochromatosis

Mutations of HFE are responsible for haemochromatosis, and a 5474A mutation (g.5474GA, C282Y) was found to be present in 83−100% of typical patients with this disorder1, 2, 3, 4. Previous studies have determined the prevalence of haemochromatosis by restriction endonuclease digestion or oligonucleotide ligation assay (OLA) of amplified genomic DNA obtained by PCR using sense primer 5´−TGGCAAGGGTAAACAGATCC−3´ and antisense primer 5´−CTCAGGCACTCCTCAACC−3´ (Fig. 1; ref. 4). A restriction endonuclease digestion assay identified 31 putative 5474A homozygotes from 5,211 individuals tested in a population-screening study of voluntary blood donors. When we validated the assay by genomic DNA sequence analysis, only 16 individuals were confirmed to be 5474A homozygotes and the remaining 15 were heterozygous for this mutation. Each of the 5474A heterozygotes was also heterozygous for a previously unrecognized 5569G/A single-nucleotide polymorphism located in the binding region of the antisense primer. We developed a new antisense primer that excluded the site of the new polymorphism (5´−TACCTCCTCAGGCACTCCTC−3´), and confirmed the 15 putative homozygotes to be 5474A heterozygotes using restriction endonuclease digestion (Fig. 2). The new polymorphism was present in 21% of 113 normal patients, corresponding to an allele frequency of 0.106 in this sample. Hill and Robertsons maximum likelihood estimate of linkage disequilibrium D (ref. 5) was 0.71 (P<0.005), confirming the presence of moderate to strong linkage disequilibrium between the 2 variant sites. It is unlikely that the 5569A polymorphism has functional significance, because it is found within intron 4 and does not disrupt a splice-site consensus sequence. Moreover, all 5474A/5569A compound heterozygotes had a transferrin saturation in the normal range (mean 31%, range 20−40%). In our population study, the prevalence of haemochromatosis was reduced from 1 in 168 to 1 in 327 by the use of the new primers. These results have major public health implications regarding the use of population screening for haemochromatosis6, 7. Individuals previously considered to be non-expressing 5474A homozygotes on the basis of a PCR-based restriction endonuclease digestion assay using the original Feder et al. primers require confirmatory testing.

Clinical features of genetic hemochromatosis in women compared with men

Hemochromatosis is one of the most common genetic diseases; in white persons, the estimated prevalence is 1 in 300 [1-3]. A candidate gene has been described on chromosome 6 [4]. Although hemochromatosis typically has an autosomal-recessive inheritance pattern, the disease has predominantly been found in men: In a review by Sheldon [5] from 1935, only 19 of 290 patients with hemochromatosis were women [5]. The phenotypic expression of hemochromatosis in women was thought to be mitigated by the beneficial effects of menstruation and pregnancy on the degree of iron overload and subsequent tissue damage, but this hypothesis has not been confirmed by a large study. Because this concept may not be correct, the diagnosis of hemochromatosis may be missed, even in women who are symptomatic. We reviewed the clinical, biochemical, and pathologic features of a large sample of homozygous women with hemochromatosis from referral centers in two countries. We then compared findings in women with hemochromatosis with those in men with the disease, matched by year of birth. Methods Patients Patients in this study were referred to the Clinique des Maladies du Foie in Rennes, France (since 1970), or the London Health Sciences Centre, London, Canada (since 1972), for assessment and treatment of hemochromatosis. New patients, including many with mild iron overload who do not have hemochromatosis, are evaluated weekly at both centers. The annual referral load of patients suspected of having iron overload has increased at both centers. During our study, hemochromatosis was diagnosed in 485 French homozygotes (137 women and 348 men) and 213 Canadian homozygotes (57 women and 156 men). The diagnosis of homozygous hemochromatosis in probands was based on clinical history; physical examination; serum transferrin saturation; serum ferritin level; and results of liver biopsy with hepatic iron concentration and hepatic iron index [6, 7]. Hepatic iron concentration was measured either from fresh liver biopsy tissue or from tissue excised from paraffin blocks. Standard lymphocyte microcytotoxicity tests in Terasaki plates [8, 9] were used for HLA-A and HLA-B typing. In probands, HLA typing was not used for diagnosis. For affected relatives in whom hemochromatosis was detected by family screening, the diagnosis was made on the basis of HLA typing that was identical to that of the proband in the same generation; diagnosis did not depend on the phenotypic expression of disease [10]. The presence of arthritis and pigmentation was determined on the basis of history and physical examination. We considered patients who required oral hypoglycemic agents or insulin to have diabetes. Cardiac disease was diagnosed on the basis of a history of congestive heart failure, physical examination, or arrhythmias requiring medical therapy. The presence of liver disease was determined according to abnormal findings on history, physical examination, blood chemistry, imaging studies of the liver, and biopsy of liver tissue. A presenting clinical event was considered to be incidental if it was not clearly related to hemochromatosis. Therefore, only patients presenting with fatigue, diabetes, liver disease, arthritis, cardiac disease, or pigmentation were considered to have had a clinical feature of hemochromatosis as the presenting symptom. Patients without these symptoms were considered to be asymptomatic. Alcohol consumption was assessed by patient history; consumption of more than 80 g of alcohol per day by men and more than 60 g per day by women was considered excessive. So that we could compare the phenotypic expression of hemochromatosis, all women who met the diagnostic criteria were considered for the study and were matched for year of birth (within 1 year) with men who had hemochromatosis and were from the same country. Fourteen Canadian women were so old that we could not match them with a man who had the same year of birth. Medical reports were checked for information on age at menopause or hysterectomy. Additional data on reproductive function, including the number of pregnancies and the use of oral contraceptives or intrauterine devices, were obtained by a questionnaire administered to 77 French women. All patients underwent weekly venesection, during which 300 to 500 mL of blood was drawn, until the serum ferritin level was approximately 50 g/L. The amount of iron removed was calculated as the number of liters of blood removed to achieve iron depletion, multiplied by 0.5 g. Only patients treated at the two tertiary centers were analyzed for exchangeable body iron because detailed venesection records were not available for other patients. Statistical Analysis Data are expressed as the differences in means or proportions with 95% CIs. Although men and women were matched for year of birth for the purpose of assembling the study groups, nonpaired testing was used because no clinically meaningful relation existed between the pairs. In fact, the age at evaluation of iron measurements and the prevalence of symptoms almost always differed for a man and woman who were born in the same year. The objective of the matching was to obtain a group of men in whom hemochromatosis was diagnosed in an era similar to that in which the women received a diagnosis of hemochromatosis rather than to match each woman with male homozygote. Correlation coefficients were calculated for the relation between iron measurements and age at presentation. Results Patient Characteristics The demographic and biochemical characteristics of all homozygotes with hemochromatosis are shown in Table 1. Two hundred sixty-six homozygotes (133 women and 133 men) were French, and 86 (43 women and 43 men) were Canadian. The median year of diagnosis was 1990 for French patients and 1988 for Canadian patients (range, 1961 to 1995). Severity of disease, as assessed by serum ferritin level, hepatic iron concentration, hepatic iron index, and percentage of patients who had cirrhosis, did not significantly differ between French and Canadian patients (data not shown). The mean age at presentation was similar in men and women, even when analysis was restricted to probands (50.9 years compared with 47.5 years; mean difference, 3.4 years [CI, 7.0 to 0.1 years]). Of 341 patients for whom HLA typing was done, 235 (69%) tested positive for HLA-A3. Table 1. Clinical and Laboratory Findings in 352 Women and Men with Hemochromatosis* Presenting Clinical Features The clinical event that led the patient to seek medical attention was incidental to the diagnosis of hemochromatosis in 36% of female probands and 45% of male probands. Among patients who presented with a symptom of hemochromatosis, women presented more frequently with fatigue and men presented more frequently with symptoms of liver disease. Presenting symptoms did not statistically differ for French and Canadian patients. Clinical Findings The prevalence of clinical findings was similar for men and women. The prevalence of cirrhosis and diabetes was higher in men, whereas the prevalence of fatigue and pigmentation was higher in women (Table 2). Table 2. Symptoms at the Time of Diagnosis in Women and Men with Hemochromatosis Clinical Features Found on Testing We compared the clinical and biochemical features of the 30 men and 65 women who were found to be HLA identical to an affected sibling by family screening. Serum ferritin levels and transferrin saturation were normal in 11 (6.2%) of these women (range, 28 to 59 years of age) and none of the men. Normal serum ferritin levels and abnormal transferrin saturation were more common in women (4.0%) than in men (1.1%). The process of assembling the study cohort resulted in the inclusion of more women than men in whom hemochromatosis was discovered through family screening, but a difference in the proportion of women without biochemical phenotypic expression was apparent when only cases discovered through family screening were considered (11 of 65 women compared with 0 of 30 men). Serum ferritin levels were lower in these women (433 g/L) than in men (1181 g/L) (mean difference, 748 g/L [CI, 467 to 1029 g/L]). In women and men, hepatic iron concentration (243 mol/g compared with 262 mol/g; mean difference, 19 mol/g [CI, 70.3 to 108 mol/g]) and amount of iron removed by venesection (3.9 g compared with 5.7 g; mean difference, 1.8 g [CI, 0.88 to 4.5 g]) did not differ significantly. Cirrhosis and Related Factors Cirrhosis occurred in only 21 women (13.8%) compared with 43 men (26%). Most patients with cirrhosis were probands; only five cases of cirrhosis were discovered in patients in whom hemochromatosis was diagnosed by family screening. Although excessive alcohol consumption was more common in male patients (36 of 176) than in female (8 of 176) patients, it was not more common in men with cirrhosis than in women with cirrhosis (Table 3). The correlation coefficient for hepatic iron concentration and amount of iron removed was 0.69 in men and 0.55 in women (P < 0.001). Table 3. Clinical and Laboratory Findings in Women and Men with Cirrhosis at the Time of Diagnosis of Hemochromatosis Effects of Age at Menopause, Hysterectomy, and Pregnancy In 81 women, menses had ceased by the time that hemochromatosis was diagnosed; the other 95 women were premenopausal. Median age at menopause or hysterectomy was 50 years (range, 25 years to 57 years). Hepatic iron concentration and hepatic iron index were higher in women in whom menstruation stopped before 50 years of age than in those in whom menstruation stopped after 50 years of age (Table 4). The correlation coefficient between age at menopause or hysterectomy and hepatic iron concentration was 0.36(P < 0.01); the coefficient between hepatic iron index and age at menopause or hysterectomy was 0.48(P < 0.01). Additional data on reproductive function obtained in 77 French women showed that the mean number of pregnancies was 2.7 2.3. No significant correlation was found be

Screening Blood Donors for Hereditary Hemochromatosis: Decision Analysis Model Based on a 30-Year Database

BACKGROUND & AIMS The high prevalence, morbidity, premature death, and benefit of early diagnosis and treatment make hemochromatosis a prime target for screening in the white population. Decision analysis techniques were used to compare the outcome, utility, and incremental cost savings of a plan to screen voluntary blood donors for hemochromatosis. METHODS The screening strategy includes sequential testing of serum unsaturated iron-binding capacity, serum transferrin saturation, serum ferritin, and either hepatic iron index or venesections to measure exchangeable body iron. Estimates of prevalence, asymptomatic intervals, probabilities of life-threatening clinical complications, symptom-specific life expectancy, and sensitivity and specificity of screening tests are based on our database of 170 hemochromatosis homozygotes and the published literature. RESULTS The screening strategy led to an incremental increase in utility of 0.84 quality-adjusted life days with an incremental cost savings of

Prophylactic Dosing of Anti Inhibitor Coagulant Complex (FEIBA) Reduces Bleeding Frequency In Hemophilia A Patients with Inhibitors Results of the Pro FEIBA Study

3.19 per blood donor screened. When the potential of identifying asymptomatic homozygous siblings was included, these values increased to 1.18 quality-adjusted life days and

Hemochromatosis and Iron Overload Screening (HEIRS) study design for an evaluation of 100,000 primary care-based adults.

12.57 per person screened. Screening remained a dominant strategy given a prevalence of hemochromatosis of > 0.0026 or an initial screening test cost of <