Peter Engler

A strain-specific modifier on mouse chromosome 4 controls the methylation of independent transgene loci

A transgene, pHRD, is highly methylated in 12 independent mouse lines when in a C57BL/6 strain background, but becomes progressively less methylated when bred into a DBA/2 background. Transgenes inherited from the mother are generally more methylated; however, this parental effect disappears following continued breeding into the nonmethylating strain. Mapping experiments using BXD recombinant inbred mice as well as other inbred strains indicate that a single strain-specific modifier (Ssm-1) linked to, but distinct from, Fv-1 is responsible for the strain effect. In addition to the methylated and unmethylated transgenic phenotypes, certain mice exhibit a partial methylation pattern that is a consequence of an unusual cellular mosaicism. The pHRD transgene, containing target sequences for the V(D)J recombinase, undergoes site-specific recombination only in lymphoid tissues. This V-J joining is restricted primarily to unmethylated transgene copies.

Hypomethylation is necessary but not sufficient for V(D)J recombination within a transgenic substrate

Although an inverse correlation between CpG methylation and V(D)J recombination has been demonstrated for both artificial substrates and endogenous genes, it is not known whether all hypomethylated targets are competent to rearrange or if other factors are required. We have created several artificial V(D)J recombination substrate transgenes whose methylation can be controlled by breeding into different genetic backgrounds. A transgene which contains the immunoglobulin heavy chain intronic enhancer rearranges efficiently in B lymphocytes when the transgene loci are unmethylated. When the same loci become methylated, upon breeding into a different mouse strain, no rearrangement can be detected. A similar transgene, but lacking the enhancer, also shows no evidence of V(D)J recombination when it is methylated. Even when this enhancerless transgene is hypomethylated, however, no V(D)J recombination can be detected in B lymphocytes. Thus, hypomethylation is required to permit V(D)J recombination but not all hypomethylated targets are capable of recombination. The results may indicate that the immunoglobulin enhancer is required for the assembly of factors involved in V(D)J recombination.

Expression of immunoglobulin genes in transgenic mice and transfected cells.

Immunoglobulin (Ig) genes are expressed sequentially (first H-, then L-chain genes) during the development of B lymphocytes. These studies, performed with transgenic mice and transfected cells, were aimed at the regulation of turning on and off the rearrangement of Ig genes. The specific recombinase is active in pre-B cells, but not in plasma cells. Production of membrane mu, but not secreted mu or gamma-2b, turns off rearrangement of H genes. Feedback inhibition of kappa-gene rearrangement requires kappa and membrane mu. Kappa alone or in combination with secreted mu does not stop recombination. Mouse lambda genes were mapped by deletion analysis and pulsed-field gel electrophoresis. The gene order is V2-C2,4-V1-C3,C1. The distance between V2 and C2 is 74 kb, but that between V1 and C3, 1 is only 20 kb. V2 and C3, 1 are over 190 kb apart. Lambda genes appear to be rearranged in a subset of B cells that do not respond to feedback inhibition at the pre-B cell stage. Lambda and kappa genes are both rearranged and potentially functional in these cells. Kappa genes may then be deleted by recombination of a sequence (described by Selsing and Siminovitch et al.) downstream of C-kappa with sequences upstream of C-kappa. Presumably the recombinase is eventually inactivated in kappa-lambda cells by a mechanism that is different from H-kappa feedback.

Identification of Ssm1b, a novel modifier of DNA methylation, and its expression during mouse embryogenesis

The strain-specific modifier Ssm1 is responsible for the strain-dependent methylation of particular E. coli gpt-containing transgenic sequences. Here, we identify Ssm1 as the KRAB-zinc finger (ZF) gene 2610305D13Rik located on distal chromosome 4. Ssm1b is a member of a gene family with an unusual array of three ZFs. Ssm1 family members in C57BL/6 (B6) and DBA/2 (D2) mice have various amino acid changes in their ZF domain and in the linker between the KRAB and ZF domains. Ssm1b is expressed up to E8.5; its target transgene gains partial methylation by this stage as well. At E9.5, Ssm1b mRNA is no longer expressed but by then its target has become completely methylated. By contrast, in D2 embryos the transgene is essentially unmethylated. Methylation during B6 embryonic development depends on Dnmt3b but not Mecp2. In differentiating B6 embryonic stem cells methylation spreads from gpt to a co-integrated neo gene that has a similarly high CpG content as gpt, but neo alone is not methylated. In adult B6 mice, Ssm1b is expressed in ovaries, but in other organs only other members of the Ssm1 family are expressed. Interestingly, the transgene becomes methylated when crossed into some, but not other, wild mice that were kept outbred in the laboratory. Thus, polymorphisms for the methylation patterns seen among laboratory inbred strains are also found in a free-living population. This may imply that mice that do not have the Ssm1b gene may use another member of the Ssm1 family to control the potentially harmful expression of certain endogenous or exogenous genes.

A linkage map of distal mouse Chromosome 4 in the vicinity of Ssm1, a strain-specific modifier of methylation.

Inactive chromosomal regions are often characterized by the presence of 5-methyl cytosine in CpG dinucleotides and by hypoacetylated histones. A direct biochemical link between CpG methylation and chromatin structure has now been established: MeCP2, a methyl cytosine-binding protein, can recruit histone deacetylases to methylated DNA (Jones et al. 1998; Nan et al. 1998). Little is known, however, about how methylation patterns are initially established. Understanding how the Ssm1locus acts may provide a clue to how these patterns are established. Ssm1,for strain-specific modifier, is a locus that affects the methylation of certain transgene loci (Engler et al. 1991, 1998; Weng et al. 1995). When the HRD342 transgene is carried in certain inbred mouse strains such as C57BL/ 6J (hereafter referred to as B6), it is heavily methylated. Upon crossing to other strains such as DBA/2J (hereafter referred to as D2), the transgene loci become hypomethylated. By using crosses with recombinant inbred mice, the locus responsible for transgene methylation has been mapped to distal Chromosome (Chr) 4 (Engler et al. 1991). We now report further localization of Ssm1in preparation for positional cloning of this gene. A 500 mouse (C57BL/6J × DBA/2J)F 1 × DBA/2 backcross was specifically designed to map Ssm1.The DBA/2 male parents carried the HRD342 transgene which was used as an indicator of Ssm1activity. The transgene array is integrated at an undetermined autosomal locus, unlinked to Ssm1.Initially parents hemizygous for the transgene locus were used (for the first 267 progeny), but the later offspring were the progeny of homozygous transgenic sires. Thus, about half of the initial 267 mice lacked the transgene, while all of the later progeny were hemizygous for the transgene locus. DNA was prepared from spleens by using the Qiagen Blood Kit (or, in a few cases, kidney or thymus DNA was prepared by proteinase K digestion followed by phenol and chloroform extractions). Simple sequence length polymorphisms (Dietrich et al. 1996) were analyzed with PCR with P-labeled primers as described (Dietrich et al. 1992). Information on the D4Mit loci was obtained from the Whitehead Institute WWW site (1999) and primers were from Research Genetics or were synthesized locally. A PstI polymorphism was used to distinguish Tnfr2 (recently renamedTnfrsf1b) alleles following PCR amplification as described (Takao et al. 1993). Similarly, Nppa (formerly known asPnd or Anf) was typed with aPvuII polymorphism. A 375-bp fragment was amplified using the primers TCTCACACCTTTGAAGTGGG and AGAAGGAGCCCATGCTGGCG. Treatment with PvuII yielded fragments of 315 bp + 60 bp for the B6 allele, but left the D2 allele uncleaved. The fragments were separated on agarose gels and visualized by ethidium bromide fluorescence. Ssm1was typed by assaying HRD342 transgene methylation by HpaII Southern blot hybridization with a transgene-specific probe (containing E. coli gpt and SV40 sequences). DNA was cleaved with BamHI and HpaII. BamHI generates a 1.7-kb fragment that contains six HpaII sites (Fig. 2A). Methylated transgenes are resistant to HpaII cleavge, while hypomethylated transgenes yield a major fragment of 0.8 kb as well as smaller fragments that are run off the gel. Progeny with theSsm1 genotype have hypomethylated transgenes similar to the parents, whileSsm1 progeny have a significant increase in transgene methylation. On the basis of the original low resolution mapping of Ssm1 with recombinant inbred mice and the available maps of SSR loci, t was considered likely that Ssm1would be in the interval between D4Mit54 and D4Mit42. Accordingly, all 500 N2 progeny were typed atD4Mit54, D4Mit42,and at least one internal locus, usually Nppa.Of these 500 mice, 457 had nonrecombinant maternal chro-

Rearrangement and Expression of Immunoglobulin Genes in Transgenic Mice

Transgenic mice are discussed which carry a rearrangement test transgene. The methylation status of the transgene varies, depending on the background mouse strain. When the transgene is bred into the C57BL/6 strain, it is completely methylated and not rearranged in lymphoid organs. After several generations of crossing into DBA/2 or SJL the transgene becomes unmethylated and rearranges at high frequency. A strain specific modifier of DNA methylation (Ssm-1) was mapped close to the Friend virus susceptibility locus (Fv-1) on mouse chromosome 4. Rearranged transgenes from spleen, bone marrow and thymus of adult mice or fetal liver were cloned and sequenced. A great variety of joints was found, with about 1/3 being in the correct reading frame. Small deletions into the V- and J-coding ends as well as N region additions contributed to the variability. The fetal joints showed no N regions. Since no functional immunoglobulin (Ig) gene can be created from this artificial test gene, the data indicate that the rearrangement mechanism of the fetus differs from that of the adult.